Skip to main content

Table 4 Primer sequences

From: Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism

Fragment Primer Primer sequence (5' to 3') Restriction site
PGK1 promoter Forward AAAAAACCCGGG TCTAACTGATCTATCCAAAACTG Xma l
  Reverse TGTTTTATATTTGTTGTAAAA AGTAGA  
ILV2 Forward TCTACTTTTTACAACAAATATAAAACA ATGATCAGACAATCTACGCTAA  
  Reverse AAAAAAGGCGCC CAAGCTTGCAATTTTTGACG Nar I
ILV3 Forward TCTACTTTTTACAACAAATATAAAACA ATGGGCTTGTTAACGAAAGT  
  Reverse AAAAAAGGCGCC CTTTGGTAGAGGTGGCTTCG Nar I
ILV5 Forward TCTACTTTTTACAACAAATATAAAACA ATGTTGAGAACTCAAGCCGC  
  Reverse AAAAAAGGCGCC ATTCGCGTTTCGGTTCTTGT Nar I
ILV6 Forward TCTACTTTTTACAACAAATATAAAACA ATGCTGAGATCGTTATTGCA  
  Reverse AAAAAAGACGTC AACATCCCAATATCCGTCCA Aat II
BAT2 Forward TCTACTTTTTACAACAAATATAAAACA ATGACCTTGGCACCCCTAGA  
  Reverse AAAAAAGGCGCC GAATTGTCTTGAGTTGCTTCTAAGGTA Nar I
qILV2 Forward TCCAAGGTTGCCAACGACACAG  
  Reverse TGTTGAGCAGCCCACATTTGATG  
qILV3 Forward TTGCACCTCCACCTCGTTACAC  
  Reverse ACCGTTGGAAGCGTTGGAAACC  
qILV5 Forward TTACGCCGTCTGGAACGATGTC  
  Reverse GAACCAATGGCAACGGCCAAAG  
qILV6 Forward TACCATGGTGCGTTGCAGTTCC  
  Reverse AGGTCTTGTTGCGTGTCTGTGC  
qBAT2 Forward GAAATCGGCTGGAAAGGCGAAC  
  Reverse CTTTGGCCAATGGACCGGTTTG  
qACT1 Forward TGGATTCTGAGGTTGCTGCTTTGG  
  Reverse ACCTTGGTGTCTTGGTCTACCG  
  1. aRestriction sites used for cloning are shown in bold. The reverse and complementary sequences used for fusion PCRs are shown in italics. The primers for qILV2 qILV3 qILV5 qILV6 qBAT2 and qACT1 amplifications were used for quantitative real-time polymerase chain reactions.