Skip to main content

Table 2 Fusion genes created with T. emersonii cbh1 for expression in S. cerevisiae

From: High level secretion of cellobiohydrolases by Saccharomyces cerevisiae

Origin of CBM Position attached Expression plasmid Recombinant yeast strain abbreviation Primers used for construction (5'-3')
T. reesei cbh1 a C-terminus pMI529 Sc[Tecbh1-TrCBM-C];
M0759c
399Trcbh1-L GCGACGAGTCAACCCTCCAGGTGGTAACAGAGGTACTACCAC
400Trcbh1-R GCGACTCGAGGGCGCGCCTACAAACATTGAGAGTAGTATGGGTTTA
H. grisea cbh1 a C-terminus pTeHg Sc[Tecbh1-HgCBM-C] Te-CBH-F TATAGAATTCTTAATTAAATGCTAAGAAGAGCTTTACTATTG
Te-CBH-R TATACGTCTCTGGACCGAATTTAATGTTGGAGTA
Hg-CBM-F TATACGTCTCGGTCCAATCGGTTCCACAGT
Hg-CBM-R TATACTCGAGGCGCGCCTTATAAACATTGAGAGTACCAGTC
C. thermophilum cbh1 a C-terminus pMI566 Sc[Tecbh1-CtCBM-C] 392ENO1p-F CAGGATCCCAATTAATGTGAGTTACC
393TeCt-R ACAGTGGATCCGATTGGACCGAATTTAATGTTGG
T. reesei cbh2 a N-terminus pMI528 Sc[Tecbh1-TrCBM-N] 406TEM CBH1 NCBM-L CCTCCGAATTCATGCTAAGAAGAGCTTTACTATTGA-GCTCTTCTGCTATCTTGGCCGTTAAGGCTCAAGCCTGCTCCTCTGTTTGG
407TEM CBH1 NCBM-R AAACTTCAAGTCACGTGGACATTGAGAGTCACAG
T. reesei cbh2 b N-terminus pDLG117 Sc[Tecbh1-TrCBM-N2] NCBM-L GAATTCATAATGGTCTCCTTC
NCBM-R AAAGCTCTCGAGTTAAGAAGC
NCBM-OL2 CGGTACCGGCTTGTTGAGAGTAAGTAGCAGTACCGG
T. reesei cbh1 b C-terminus pDLG118 Sc[Tecbh1-TrCBM-C2] CCBM-L GAATTCATAATGGTCTCCTTC
CCBM-R AATCAAAAGCTCTCGAGTTAC
CCBM-OL2n GTTACCACCTGGAGGGTTAGAAGCAGTGAAAGTGGAG
  1. a Native secretion signal; bT. reesei xyn2 secretion signal; cdiploid ura3Δ/ura3Δ FUR1/fur1Δ strain which has a functional xylose pathway i.e. over expressed pentose pathway genes and Piromyces xylA, and gre3 deleted.