Skip to main content

Table 3 Primers for genomic DNA amplification.

From: Mychonastes aferHSO-3-1 as a potential new source of biodiesel

Primer Sequence 5' → 3'
18SF CCTGGTTGATCCTGCCAG
18SR TTGATCCTTCTGCAGGTTCA
ITS4 TCCTCCGCTTATTGATATGC
ITS5 GGAAGTAAAAGTCGTAACAAGG