Skip to main content

Advertisement

Table 3 Primers used in the identification of the isolated strains (18S rDNA) and determination of axenicity status of established microalgal cultures (16S rDNA)

From: Microplate-based high throughput screening procedure for the isolation of lipid-rich marine microalgae

Gene Primer Sequence (5' to 3')
18S 18SUnivFor ACCTGGTTGATCCTGCCAGT
18S 18SUnivRev TCAGCCTTGCGACCATAC
16S F27 AGAGTTTGATCMTGGCTCAG
16S R1492 TACGGYTACCTTGTTACGACTT