Skip to main content

Table 2 Primers useda

From: Isolation of xylose isomerases by sequence- and function-based screening from a soil metagenomic library

Primer Sequence
DF1 5' AAGCT(A/C/G/T) GG(A/C/G/T) G(C/T)(A/C/G/T) CCT T(C/T)(C/T) TATTGTTT(C/T) CACGAC 3'
DR2 5' TCCTCC(A/C/G/T) TGCTG(C/T)(T/A)(T/A) GCCGCC(A/C/G/T) CC(A/C/G/T) CG(A/C/G/T) AG(A/G) AT 3'
DF2 5' GGT(A/G) T(A/C/G/T) AA(A/G) CT(A/C/G/T) CTCTGGGG(A/C/G/T) CAGGCCAA(C/T) CT(A/C/G/T) TT(C/T) 3'
DR1 5' (A/G) TG(C/T) TTCTGGGG(C/T) TC(C/T) TGCGGCTTGGGCTC (A/C/G/T) A(T/G) 3'
pRSETBF 5' GGTGGACAGCAAATGGGTCGG 3'
pRSETBR 5' GGGCTTTGTTAGCAGCCGGATC 3'
XYM1F 5' CCTGGATCC ATGAGCGTTGTTCTTGGCGACAAAG 3'
XYM1R 5' TGGGTCGAC TTACCGGATCCACCGGTTCATAATG 3'
XYM2F 5'CAGGAATTC ATGAAACTTACCGTAGGAGACAAGG 3'
XYM2R 5' TGGGTCGAC TTAAATAAACCTGCTAATCAAATTCTCAATATAC 3'
  1. aRestriction sites, when present, are underlined.