Skip to main content

Table 2 Primers used for gene deletions

From: Competition between pentoses and glucose during uptake and catabolism in recombinant Saccharomyces cerevisiae

Δ hxk1for 5'-ATGGTTCATTTAGGTCCAAAGAAACCACAGGCTAGAAAGGGTTCCATGGCTTCGTACGCTGCAGGTCGAC-3'
Δhxk1rev 5'-TTAAGCGCCAATGATACCAAGAGACTTACCTTCGGCAATTCTTTTTTCGG GCATAGGCCACTAGTGGATCTG-3'
Δglk1for 5'-ATGTCATTCGACGACTTACACAAAGCCACTGAGAGAGCGGTCATCCAGGC TTCGTACGCTGCAGGTCGAC-3'
Δglk1rev 5'-TCATGCTACAAGCGCACACAAGGCGGCACCCACTCCGGAACCATCCTTGG GCATAGGCCACTAGTGGATCTG-3'
Δhxk2for 5'-ATGGTTCATTTAGGTCCAAAAAAACCACAAGCCAGAAAGGGTTCCATGGC TTCGTACGCTGCAGGTCGAC-3'
Δhxk2rev 5'-TTAAGCACCGATGATACCAACGGACTTACCTTCAGCAATTCTTTTTTGGG GCATAGGCCACTAGTGGATCTG-3'
Δylr446wfor 5'-ATGACAATTGAAAGCACTCTAGCTCGGGAATTAGAAAGCTTGATTTTACC TTCGTACGCTGCAGGTCGAC-3'
Δylr446wrev 5'-TTATTGAACTTGGTTGTCTGATTTGTTCAAGTAGGTGGCTATTGCAGCGCC GCATAGGCCACTAGTGGATCTG-3'
  1. Homology to the hexo-/glucokinase genes, bold; homology to kanMX cassette, italic.