Skip to main content

Table 1 Primers for real time RT-PCR in this study

From: Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

Gene name Primers for real time PCR (5'--3') Product length (bp)
BC F CAAGAAGGTGATGATCGCCA 120
  R GACGTGCAGCGAGTTCTTGTC  
ACP F CAGCTCGGCACTGACCTTG 120
  R CAAGGGTCAGCTCGAACTTCTC  
MCTK F GGTGAGGACAAGGCGGTG 120
  R TCATCCTGGCCTTGAAGCTC  
KAS F CACCCCACTCTGAACCAGGA 120
FATA F AGACTCGTTCAGCGAGGAGC 120
  R CTTGATAGGCATGCTGGGTGT  
ACT F ACCTCAGCGTTCAGCCTTGT 120
  R TGGTCCACGACACCATCAAC