Skip to main content

Table 2 Domain-level primers used to amplify short-subunit rDNA genes from DNA extracts of biomass compost

From: Tracking dynamics of plant biomass composting by changes in substrate structure, microbial community, and enzyme activity

  Genes Primer sequences & reference Amplicon size(bp)
Archaea 16 s rDNA F: TTCCGGTTGATCCYGCCRG
R: YCCGGCGTTGAMTCCAATT
Ref: [22]
937
Bacteria 16 s rDNA F: TCCTACGGGAGGCAGCAGT
R: GGACTACCAGGGTATCTAATCCTGTT
Ref: [25]
466
Fungi 5.8 s and ITS2 rDNA F: GCATCGATGAAGAACGCAGC
R: TCCTCCGCTTATTGATATGC
Ref: [22, 26]
400