Skip to main content

Table 3 Subgenus- and species-level primers used to determine the transcriptional levels of fungal cellulolytic genes in biomass compost

From: Tracking dynamics of plant biomass composting by changes in substrate structure, microbial community, and enzyme activity

Enzyme type/core species Target gene/enzyme Genbank accession No. or reference Primer sequences [I] Amplicon size (bp)
Trichoderma spp. ITS - F: TACCAAHCTGTTGCCTCGGCGG ~200
    R: GATGAAGAAGGCAGCGAAATGCGATA  
Cellulase/Trichoderma spp. cbh 1/Cel7 A [II] F: GATGATTACTACGCCAACATGCTG 77
  bgl 1/Cel3 A [IV] F: ATCAAGGTAGCTCAACATCGGG 124
    R: ACCTTATCTTGGAGATTGAGCTTTGCC  
Ligninase/Phanerochaete chrysosporium LipA/B M37701 F: ATCTCTGCCCACCCTGTCCT 256
    R: CTGAGCCAGCGAATGAGAGTC  
  LipH M24082 F: CGTCCACGGATATCGCTCTCT 102
    R: GCGAGGGAGACGCAAATTC  
    R: TGTTCGGGTGGAAATTGGTC  
  1. Note: the group primers targeting specific functional protein-encoding genes:
  2. [I]. Orpinomyces spp. endo-1,4-glucanase gene: O. sp. PC-2, U97153; O. joyonii, AF015248.
  3. [II]. Trichoderma spp. cellobiohydrolase I gene (cbh 1): T. koningii, X69976; T. reesei, DD393553-DD393571; T. sp. FJ026620; T. viride, AY368686.
  4. [III]. Trichoderma spp. endo-β-1,4-glucanase I gene (egl 1): T. longibrachiatum, X60652; T. reesei, AY928809; T. viride, AY343986
  5. [IV]. Trichoderma spp. β-glucosidase 1 gene (bgl 1): T. reesei, U09580; T. sp. SSL, FJ040193; T. viride, AY368687
  6. [V]. Trichoderma spp. xyn 1 and xyn 2: T.reesei, X69573 (xyn 1), U24191 (xyn 2); T. harzianum, EU821597 (xyn 2); T. pseudokoningii, EU360941 (xyn 2).