Skip to main content

Table 1 Summary of fatty acid and lipid biosynthetic genes in this study

From: Expression of fatty acid and lipid biosynthetic genes in developing endosperm of Jatropha curcas

Gene Category1 Forward primer (5’–3’) Reverse primer (5’–3’) Accession no.
Ketoacyl ACP synthase I (KAS I) I TGGTTGGTCTTCTTTCCCTC ACAAACCCACCAGCTTCATAG JQ806261
Ketoacyl ACP synthase II (KAS II) I ACAGTCACCTTGTTTTTGTTCC ATGCTAATTTACCCTGATAAGG JQ806262
Ketoacyl ACP synthase III (KAS III) I CAATTATTAGATGGGGCTGAAG TATGTGACAACAGAAACCAAGC JQ806263
3-ketoacyl-CoA reductase isoform 1 (KCR1) I TCCTTTATTTGGGGTTTGTTAC AGCAACCTAAAAGTTCAATTCC JQ806264
3-ketoacyl-CoA reductase isoform 3 (KCR3) I ATGGACAGTAACATAGCCAATC TCCACACACTTTTTCACAACTG JQ806266
Acyl carrier protein1 (ACP1) I ACCGTTCAGGAAGCTGCTG ACATAGTTCACAACAAGATTGC JQ806272
Acyl-CoA dehydrogenase (ACD) I AATTGCAGATGGCCCCGATG AGTTTTTGTGTGCTGGTATTGG JQ806273
Semialdehyde decarboxylase 1 (SAD1) I GGGGCAGTGATTTTCCATTTG GTGCTTTTTCCATATCTAATGAC JQ806274
Hydroxyacyl-ACP dehydratase (HAD) I CTGCTATCCTATGCCTTTTTTG GTTTTGCCCATAAGTTTAACATC JQ806275
Acyl-ACP thioesterase (FATA) I TATTTGTGTGGGCATCTGCC TAGTTGGTAAGGTGGGTTTAAC JQ806276
Enoyl-ACP reductase (EAR) I ATGGGTGTGGGAGTTGACAG GTGACATGGCATGGATTAAATG JQ806277
Phosphatidic acid phosphatase β (β-PAP) I CACGAGCCCCATTCTGGAC AGTCTGTTCAAGGTCAGGGG JQ806281
CDP-diacylglycerol synthase (CDP-DAG) I CTAATAACAGTGTCATGGCAG TTCCATATTCACTAAGTGCATTG JQ806282
Digalactosyldiacylglycerol synthase 1 (DGD1) I AGACCTGCATCTCTACCTCC GGTGCTGCCTAAATCTATATTC JQ806283
Monogalactosyldiacylglycerol synthase (MGD2) I GTGTAAAGAATGGCAAGCATG CCCCTAAAAGAATCAGAAACC JQ806284
Phosphatidylinositol synthase (PTS) I CTTTTCATCTTCTGTGTCCATG TAGTCAATAACCATCTCGTGC JQ806287
Short-chain acyl-CoA oxidase (SCAOX) I AGGTTCTGCTTTTGCGCTAC GGTCCCCTAGCTGGTAATTC JQ806289
Long-chain acyl-CoA oxidase (LCAOX) I TGCACCAAGAGTATGATAGGC TTACGTTTCTTTGTTCCAGCC JQ806290
Acyl-CoA oxidase (AOX) I CCGTAATGCAAGACTGTGAAG TTGCCATTAACTTGGATACAGC JQ806291
Long-chain acyl-CoA synthetase (LACS) I CAAGAGAGAGGCCATCAGG AAAATCCAAGAGAAACAGCAAG JQ806292
Oleosin 3 (Oleosin 3) I AAGAGAAGTGGGTTTTGGTGG AGAAACAAAAAGATTTAAGCG JQ806304
Diacylglycerol kinase (DGK) I GTGGCTCAGATTTGGGTTGC AAACTATTGAAGCTAAGCCTGG JQ806306
D-erythro-sphingosine kinase/diacylglycerol kinase (DeDGK) I ATCAAATTCAGGAAAAGTAGCG AATCAAACTGCACAAAAGGAAC JQ806308
Calmodulin-binding diacylglycerol kinase (cDGK) I AGAAGATAAGGAAGAGCGAAG GTTATAGCCTACAGCCAAAGC JQ806309
Protein phosphatase 2C (PP2C) I TCATGGGCTTAAATGTGTGTAC AACTCATACTTGAAAAGCTAAGG JQ806311
Tyrosine phosphatase (TP) I TGGCCGTTTGTTAAG ATTGATC ATTGACTTCATAATGTTGACCC JQ806312
Phosphoglycolate phosphatase (PGP) I ATGCTGATGGGCTTTACTTTG AGAACTAGCAAACTCCTTCCC JQ806314
Lysophosphatidyl acyltransferase 1(LPAT1) I CTGAAGGTTAGTGCAACAAATG GTAACATCGTCTGGAAAATTGC JQ806317
Lysophosphatidyl acyltransferase 2 (LPAT2) I CTTTGGTTTCATGTGCTGCAC ATACATGAAAAGAAAAGGTGCC JQ806320
Lysophosphatidyl acyltransferase 5 (LPAT5) I TTTGGCATCTGCAACCTATTTC GCCATAAACAGGTATGAGTCTC JQ806319
Diacylglycerol acyltransferase (DGAT1) I GACCTAATGAATCGGAAAGGC CCGCATAGCCAAAATTGCTTG JQ806316
Phospholipid/glycerol acyltransferase (PL/GA) I TAAAGTATTCTCGCCCTAGCCC ACATTTGCTTCTGTTTTCATGC JQ806322
Triacylglycerol lipase (TAGL) I GTGAATACTGTTGTAAGCCTG GTCCAAAAACACCAATGAAATG JQ806324
Phospholipase C (PLC) I CAGCTCAATGGTGATTATGTC AGCTTTTATGTAATTTGCGTCG JQ806325
Phospholipase D (PLD) I ACTATGGGCAGAGCATGTTG TCACATCCAGGAATAGCCTC JQ806326
Phospholipase D α (PLDα) I CGCCAAATCTGATTACCTCC CACTGATATGAACATCCTGGC JQ806327
Phosphatidylinositol 4-kinase (P4K) I AAGACTTCTAGGGTTTGTGGG CTCCTCAGTCCTCACTTAGC JQ806329
Putative phosphatase (PP) I TGGGAAGATGCCATGTCTATC CCAAACAAGAGATAAACTAACAG JQ806330
Fatty acid desaturase (FAD) I ATGACCAATCCTGTTCCAAAG TGCTAATGTTTACAAATGAGGG JQ806294
Fatty acid desaturase 5 (FAD5) I ACTTGGTATGTTGTGAGGTTTC ATGTAGAAAAGCTAATGCCCC JQ806295
Fatty acid desaturase 6 (FAD6) I TTGCCCCTGAAGAATCTCAAC ATTCATATTACTGTCCTCCCC JQ806296
Acyl-ACP desaturase (AAD) I AGTTTTTGATCGGACGGTGG AAAGAGAAGAAAGCAAGACTCG JQ806300
δ-12-acyl-lipid desaturase (DALD) I GCTATAATATGTGGTTTGGCC GTTGTAGAGTTCCATAAACGG JQ806301
δ-7-C-5 sterol desaturase (D7SD) I TCTTGCATAGGCATCCATTTC AGATCGAGTACATGGCTATGG JQ806302
δ-9-stearoyl-acyl carrier protein desaturase (D9SD) I TGTTTGGAGAAGACATACCGG CAGGGCTGTGGTGACTTAC JQ806303
δ-12 fatty acid conjugase (D12FAC) I AGCCAGAAGAGGGAGGTCC AACTCAAACACCACTTTCCCG JQ806298
Fatty acid desaturase 2 (FAD2) I TGGACTACTTGTTAGGAATTTG GTTCATATTGTTTCTACCTGGG JQ806297
Sterol desaturase (SD) II CTGATGAAGGCACACTGTTG GTAGAAACATAATCCACTGCC JQ806299
3-ketoacyl-CoA reductase isoform 2 (KCR2) II CGTCTCTCTCTCGGAATCC TCTTCTGTGAAAACGACCCTC JQ806265
Enoyl-CoA hydratase (ECH) II AGATTGGAGGAATGGTCAAAG TATTGCTTGCTAGGATTGGAG JQ806267
Oleosin (Oleosin) II TGGACAGTATATGCAACACAAG TATTCCACACTGAAATTAGCAC JQ806305
Long-chain acyl-CoA synthetase 8 (LACS8) II TTTGTTTAATGTGCTTTCCTCC GTCCTGCAATTTAGGTGAAGC JQ806293
Diacylglycerol kinase 1 (DGK1) II TGGCACTTAGGCTGACTTAG CAGCTAAAAGCACCAAGTTAAG JQ806307
Lysophosphatidyl acyltransferase 4 (LPAT4) II ATTTTAGCATGTGCATTCCTTG TATAAACAAGTTCACAAAAAGGTC JQ806318
Lipase (Lipase) II TGGGGTTCAATGCCAAAGAC TAGCCTGTCTACAGATTTTCC JQ806323
Ketoacyl-CoA synthase (KCS) III CTTTGATTTGTACTTTCATGGG AACACACAAGCATTTGAAGCC JQ806268
Choline kinase (CLK) III TATTTCTTCCTGCGATACAATG TTTGGATCTTAAATCTGGCTAC JQ806313
Protein phosphatase 2A (PP2A) IV TGATGTTACCCGTAGAACTCC ATAAAAAAAAACAAAACCTGCCC JQ806310
Ketoacyl ACP reductase (KAR) IV CGGAAGAGGTTGCAGGATTG AAAAACTGCCTCAACACAAGC JQ806278
Phosphatidic acid phosphatase α (α-PAP) IV ATGGGGCTATATTTGGCTCAC CTTGGAAACCTGATAAACAAAAG JQ806280
Cholinephosphate cytidylyltransferase (CPC) IV GACAAAGATGATGCTAAGGAG TATTCCTATCCTCACAACAAGC JQ806285
Cyclopropane-fatty-acyl-phospholipid synthase (CFAS) IV GACTTGTCTTCCTGAGAGCC GCAGTTCTTTGAAAGCGATGG JQ806286
Sulfoquinovosyldiacylglycerol synthase type 2 (SQD2) IV GCAGCCACTAGAAAAATCCG GCAGAGCAAATCCGTCACC JQ806288
Phosphotyrosine protein phosphatase (PPP) IV ATGTGCTCCTTTTGTAAGAAAC AACTTTGAATGCCGCTGGTC JQ806315
Glycerol-3-phosphate acyltransferase (G3PAT) IV GGCAGTAATGTCTTTGGTTTC TACATGAAAAGAAAGGGTGCC JQ806321
Phosphatidylinositol 3-kinase (P3K) IV TGGAGTTTGCTCAAGGAGTC TTAAAAAAGAGCTGAAAGACACC JQ806328
Malonyl CoA ACP transacylase (MCAT) V GTTATTGCTGGCATTGTCAAG GAAATCTCTAGTACATGACGC JQ806279
Lipid phosphate phosphatase 3 (LPP3) V TCTGAGACGAGCGGAGGAC ATTCATCATCTCCTTCCAGTTC JQ806270
Jatropha Actin 1 protein (Actin1) Control TAATGGTCCCTCTGGATGTG AGAAAAGAAAAGAAAAAAGCAGC JQ806331
  1. 1The genes can be grouped into five categories based on their expression patterns during endosperm development. Please refer to the text for details.