Skip to main content

Advertisement

Table 2 Primers used in this study

From: Boosting the free fatty acid synthesis of Escherichia coli by expression of a cytosolic Acinetobacter baylyi thioesterase

Name Sequence (5’→3’)
AcTesA-NcoF CTAGCCATGG GCAAAACCATTCTTATCTTAGGCG
AcTesA-BamHR CAGGGATCC TTATAAAGCGCCTTTAATATATGG
rAcTesA-SacF GACGAGCTC AGGAGGTAAAAAAACATGGGCAAAACCATTCTTATCTTAGGCG
AcTesA-HindR CTACCAAGCTT TTATAAAGCGCCTTTAATATATGG
S10A-F CTTATCTTAGGCGACGCT CTGAGTGCGGGTTATGG
S10A-R CTCAGAGC GTCGCCTAAGATAAGAATGGTTTTGCC
G48A-F GCCAGTGTAAGTG C G GAAACCACCAGTGGTGC
G48A-R GTTTCCGC ACTTACACTGGCATTAATGACTTTATG
N77A-F GAGCTTGGTGGTGCT GATGCATTAAGAGGAC
N77A-R GCATCAGC ACCACCAAGCTCAATGACCACCAC
D158A-F CTAATGCAAAATGCC CAGATCCATCCAAATGC
D158A-R CTGGGC ATTTTGCATTAGACTTTTGTGTCCAG
H161A-F CAAAATGACCAGATCGCT CCAAATGCCAAAGCCCAG
H161A-R CATTTGGAGC GATCTGGTCATTTTGCATTAGACTTTTG
  1. Underlines indicate restriction enzyme sites or mutagenized codons.