Skip to main content

Table 3 Strains, plasmids, and primer sequences used in this study

From: Efficient production of l-lactic acid by an engineered Thermoanaerobacterium aotearoensewith broad substrate specificity

Strains   Source
T. aotearoense SCUT27 Wild type strain [11]
DH5α E. coli cloning strain, F-endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZ∆M15 ∆(lacZYA-argF)U169, hsdR17(r K -m K +), λ Invitrogen
LA1002 As SCUT27, but ∆pta, ∆ack This study
Plasmids Description Source
pBluescript II SK(+) Standard cloning vector, f1 ori; AmpR; Stratagene
pBlue-aph Derived from pBluescript II SK(+), with kanamycin expression cassette This study
pBlue-pta-aph Derived from pBlue-aph, with partial phosphotransacetylase (pta) gene upward of kanamycin gene This study
pPuKAd Homologous recombination plasmid derived from pBlue-pta-aph, with partial acetate kinase (ack) gene downward of kanamycin gene This study
Primers Sequence 5′ → 3′) a Application
Prob-F TATTAAGACCTGCATTTCAGAT Forward primer for hybridization probe
Prob-R CATTTGCCTTAGCTAACCTC Reverse primer for hybridization probe
  1. a Underlined nucleotides indicate restriction enzyme sites.