Skip to main content

Table 2 Oligonucleotides used in this study

From: Carbon dioxide fixation by Calvin-Cycle enzymes improves ethanol yield in yeast

Number Name Sequence (5′ to 3′) Purpose
  Cloning   
1 XbaI_prk_FW2 TGACATCTAGATGTCACAACAACAAACAATTG Cloning of PRK into pUDE046.
2 RV1 XhoI prk TGACATCTAGATGTCACAACAACAAACAATTG Cloning of PRK into pUDE046.
  Primers used for in vivo plasmid assembly  
3 HR-cbbM-FW-65 TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACAGCTGGAGCTCAGTTTATCATTATC Rubisco cbbM cassette for plasmids pUDC075, pUDC099, and pUDC100.
4 HR-cbbM-RV-65 GGAATCTGTGTAGTATGCCTGGAATGTCTGCCGTGCCATAGCCATGTATGCTGATATGTCGGTACCGGCCGCAAATTAAAG Rubisco cbbM cassette for plasmids pUDC075, pUDC099, and pUDC100
5 linker-cbbO2-pRS416 ATCACTCTTACCAGGCTAGGACGACCCTACTCATGTATTGAGATCGACGAGATTTCTAGGCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGC Linker fragment for assembly of plasmid pUDC099.
6 linker-cbbM-GroEL GACATATCAGCATACATGGCTATGGCACGGCAGACATTCCAGGCATACTACACAGATTCCATCACTCTTACCAGGCTAGGACGACCCTACTCATGTATTGAGATCGACGAGATTTCTAGG Linker fragment for assembly of plasmid pUDC100.
  Primers used for in vivo integration assembly  
7 FW pTDH3- HR-CAN1up GTTGGATCCAGTTTTTAATCTGTCGTCAATCGAAAGTTTATTTCAGAGTTCTTCAGACTTCTTAACTCCTGTAAAAACAAAAAAAAAAAAAGGCATAGCAAGCTGGAGCTCAGTTTATC 1st cloning expression cassette linker fragment between CAN1 upstream and PRK expression cassette (IMI229), and CAN1up-linker and KlLEU2 expression cassette (IMI232).
8 RV linker-iHR2B AGATATACTGCAAAGTCCGGAGCAACAGTCGTATAACTCGAGCAGCCCTCTACTTTGTTGTTGCGCTAAGAGAATGGACC 1st cloning fragment: linker fragment between CAN1up-linker and PRK expression cassette (IMI229).
9 RV linker-iHR6 GCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGTTGCGCTAAGAGAATGGACC 1st cloning fragment: linker fragment between CAN1up-linker and KlLEU2 expression cassette (IMI232).
10 FW pGAL1-prk HR2B CAACAAAGTAGAGGGCTGCTCGAGTTATACGACTGTTGCTCCGGACTTTGCAGTATATCTGCTGGAGCTCTAGTACGGATT 2nd cloning fragment: GAL1p-PRK-CYC1t expression cassette (IMI229) from pUDE046.
11 RV CYC1t-prk HR2 GGAATCTGTGTAGTATGCCTGGAATGTCTGCCGTGCCATAGCCATGTATGCTGATATGTCGTACCGGCCGCAAATTAAAG 2nd cloning fragment: GAL1 p-PRK-CYC1t expression cassette (IMI229) from pUDE046.
12 FW HR2-cbbQ2-HR3 GACATATCAGCATACATGGCTATGG 3rd cloning fragment: PGI1p-cbbQ2-TEF2 t cassette (IMI229).
13 RV HR2-cbbQ2-HR3 GGACACGCTTGACAGAATGTCAAAGG 3rd cloning fragment: PGI1p-cbbQ2-TEF2 t cassette (IMI229).
14 FW HR3-cbbO2-HR4 CGTCCGATATGATCTGATTGG 4th cloning fragment: PGK1p-cbbO2-ADH1t cassette (IMI229).
15 RV HR3-cbbO2-HR4 CCTAGAAATCTCGTCGATCTC 4th cloning fragment: PGK1p-cbbO2-ADH1t cassette (IMI229).
16 FW HR4-GroEL-HR5 ATCACTCTTACCAGGCTAGG 5th cloning fragment: TEF1p-groEL-ACT1t cassette (IMI229).
17 RV HR4-GroEL-HR5 CTGGACCTTAATCGTGTGCGCATCCTC 5th cloning fragment: TEF1p-groEL-ACT1t cassette (IMI229).
18 FW HR5-GroES-HR6 CCGTATAGCTTAATAGCCAGCTTTATC 6th cloning fragment: TPI1p-groES-PGI1t cassette (IMI229).
19 RV HR5-GroES-HR6 GCTATGACCATGATTACGCCAAGC 6th cloning fragment: TPI1p-groES-PGI1t cassette (IMI229).
20 FW HR6-LEU2-CAN1dwn CCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCCTGTGAAGATCCCAGCAAAG 7th (IMI229) or 2nd (IMI232) cloning fragment: KlLEU2 cassette from pUG73.
21 RV LEU2 HR-CAN1 AGCTCATTGATCCCTTAAACTTTCTTTTCGGTGTATGACTTATGAGGGTGAGAATGCGAAATGGCGTGGAAATGTGATCAAAGGTAATAAAACGTCATATATCCGCAGGCTAACCGGAAC 7th (IMI229) or 2nd (IMI232) cloning fragment: KlLEU2 cassette from pUG73.
  Primers used for verification of the in vivo assembled constructs  
22 m-PCR-HR1-FW GGCGATTAAGTTGGGTAACG Diagnostic for assembly of plasmids pUDC075, pUDC099, and pUDC100, and integration in strain IMI229.
23 m-PCR-HR1-RV AACTGAGCTCCAGCTGTACC Diagnostic for assembly of plasmids pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
24 m-PCR-HR2-FW ACGCGTGTACGCATGTAAC Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229
25 m-PCR-HR2-RV GCGCGTGGCTTCCTATAATC Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229
26 m-PCR-HR3-FW GTGAATGCTGGTCGCTATAC Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
27 m-PCR-HR3-RV GTAAGCAGCAACACCTTCAG Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
28 m-PCR-HR4-FW ACCTGACCTACAGGAAAGAG Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
29 m-PCR-HR4-RV TGAAGTGGTACGGCGATGC Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
30 m-PCR-HR5-FW ATAGCCACCCAAGGCATTTC Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
31 m-PCR-HR5-RV CCGCACTTTCTCCATGAGG Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
32 m-PCR-HR6-FW CGACGGTTACGGTGTTAAG Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.
33 m-PCR-HR6-RV CTTCCGGCTCCTATGTTGTG Diagnostic for assembly of pUDC075, pUDC099, pUDC100, and integration in strain IMI229.