Skip to main content

Table 2 List of the primers for JC7-1 RBIP detection

From: Structural characterization of copia-type retrotransposons leads to insights into the marker development in a biofuel crop, Jatropha curcasL.

Name Primer sequence (5′-3′)
FLKL CAAAGCACACGAGGATTCAG
FLKR CAGGTCCAAATCTCCTCGTG
LTRL GAAAATTAAATCCAACATGT
LTRR GAGATTAATTCTTAACAGAA