Skip to main content

Advertisement

Table 3 PCR primers used to generate the cassettes for deleting STL1 , GUT1, and GUT2 in CBS 6412-13A and for the PCR-based verification of the respective deletions

From: Re-evaluation of glycerol utilization in Saccharomyces cerevisiae: characterization of an isolate that grows on glycerol without supporting supplements

Gene Primer Sequence (5′-3′)
STL1 astl1-loxP-fw CACTCATAGTATATAAACAAGCCCTTTATTGATTTTGAATAATTAcagctgaagcttcgtacgc
  astl1-loxP-rv TCAAAGCCCTCTGAAGATTTTGGGACCTGCCTCTGGAGAACAAACgcataggccactagtggatctg
  bverif-stl1∆-fw TGGTTCACCTTTGATAGGGC
  bverif-stl1∆-rv TGAAACTGCTTGACCTGTGG
GUT1 agut1-loxP-fw TGTGGGGGGATGCCTGTTCTCGAACCATATAAAATATACCATGTGcagctgaagcttcgtacgc
  agut1-loxP-rv CTAGATCTCGCAGTACTGTTTTTGGCGAATCGTGTAGCTTTTCCAgcataggccactagtggatctg
  bverif-gut1∆-fw GTGTGGAGTAGCATAGTGAGG
  bverif-gut1∆-rv AATGCTAGAGTCGTCAGTGCG
GUT2 agut2-loxP-fw GTCTAAAGCAAGGACTCTCCCTCCCTTATCTTGACCGTGCTATTGcagctgaagcttcgtacgc
  agut2-loxP-rv TTGCAAAATGGCGTCACTGTATGGGCCCGTGGCATTGACCACACAgcataggccactagtggatctg
  bverif-gut2∆-fw TCCGATACGTTATCCACCCAA
  bverif-gut2∆-rv TTCCTCAGCCATTTGTCTGT
  1. aGene deletion cassettes; sequences complementary to the loxP regions within the disruption cassettes are shown in lower case.
  2. bVerification of gene deletions.