Skip to main content

Advertisement

Table 4 Allele-specific primers used for the differentiation between the STL1 , GUT1, and GUT2 alleles from CEN.PK113-1A and CBS 6412-13A, respectively

From: Re-evaluation of glycerol utilization in Saccharomyces cerevisiae: characterization of an isolate that grows on glycerol without supporting supplements

Gene Primer Sequence (5′-3′)
STL1 Primers for specific amplification of STL1 CEN.PK113-1A Forward: GGTTGTTTCGCAGGTTCTCTT
Reverse: ACTTCCTCATCATTTGGATCT
Primers for specific amplification of STL1 CBS 6412-13A Forward: GGTTGTTTCGCAGGTTCTCTA
Reverse: ACTTCCTCATCATTTGGATCC
GUT1 Primers for specific amplification of GUT1 CEN.PK113-1A Forward: GCAAACATGAGAGAAACCACA
Reverse: AATTTCGGGCATGTGAATCAG
Primers for specific amplification of GUT1 CBS 6412-13A Forward: GCAAACATGAGAGAAACTACG
Reverse: AATTTCGGGCATGTGAATCAA
GUT2 Primers for specific amplification of GUT2 CEN.PK113-1A Forward: CGCCACTTTAGCCATTACC
Reverse: GTGTGACAAGGTTTCAGGTTG
Primers for specific amplification of GUT2 CBS 6412-13A Forward: CGCCACTTTAGCCATCACG
Reverse: GTGTGACAAGGTTTCAGGTTA