Skip to main content

Table 3 PCR primers used in the study with the relevant restriction sites in italics (Eco RI = GAATTC; Xho I = CTCGAG)

From: Raw starch conversion by Saccharomyces cerevisiae expressing Aspergillus tubingensis amylases

Primer name Sequence (5’-3’) Reference
cDNA amyA   [GenBank: AB008370]
  AmyA-L AAGAATTC CGCTTCGCCAAG
  AmyA-R CT GAATTCCTCGAG ATCAACCACCGTC
cDNA glaA   [GenBank: D10460]
  GlaA-L CAGAATTC CACCGCAATGTCGTTC
  GlaA-R AGCTCGAG AATAGTCTACCGCCAGGT
Identification   [41]
  ITS1 TCCGTAGGTGAACCTTGCGG
  ITS4 TCCTCCGCTTATTGATATGC