Skip to main content

Table 2 Strains, plasmids, and oligonucleotides

From: Development of an electrotransformation protocol for genetic manipulation of Clostridium pasteurianum

Strain Relevant characteristics Source or reference
Escherichia coli DH5α F-endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG ϕ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(r K -m K +), λ- Lab stock
Escherichia coli ER1821 F-endA1 glnV44 thi-1 relA1? e14-(mcrA-) rfbD1? spoT1? Δ(mcrC-mrr)114::IS10 Lab stock; New England Biolabs
Clostridium pasteurianum ATCC 6013 Wild-type American Type Culture Collection
Plasmid Relevant characteristics Source or reference
pET-20b(+) E. coli pET-series expression vector (ApR; ColE1 ori) Novagen
pETKnFRT Derived by inserting the FRT-flanked kan gene of pKD4 into the MCS of pET-20b(+) (ApR; ColE1 ori; FRT-KnR-FRT) This study
pFnuDIIM The M.FnuDII methyltransferase gene of Fusobacterium nucleatum inserted into the tet gene of pACYC184 (p15A ori; CmR) [65]
pFnuDIIMKn Derived by inserting the FRT-flanked kan gene of pETKnFRT into the cat gene of pFnuDIIM (p15A ori; KnR) This study
pHT3 E. coli-C. pasteurianum shuttle vector containing lacZ from Thermoanaerobacterium thermosulfurogenes EM1 (ApR; ColE1 ori; ErmR; pIM13 ori) [49]
pIMP1 E. coli-C. pasteurianum shuttle vector (ApR; ColE1 ori; ErmR; pIM13 ori) [26]
pKD4 Template vector (ApR; pR6K ori; FRT-KnR-FRT) [70]
pMTL82151 E. coli-C. pasteurianum shuttle vector (CmR; ColE1 ori; pBP1 ori) [34]
pMTL83151 E. coli-C. pasteurianum shuttle vector (CmR; ColE1 ori; pCB102 ori) [34]
pMTL84151 E. coli-C. pasteurianum shuttle vector (CmR; ColE1 ori; pCD6 ori) [34]
pMTL85141 E. coli-C. pasteurianum shuttle vector (CmR; ColE1 ori; pIM13 ori) [34]
pMTL85141ermB Derived by insertion of the ermB gene of pIMP1 into pMTL85141 This study
pSC12 E. coli-C. pasteurianum shuttle vector (CmR; ColE1 ori; pIM13 ori) [66]
pSY6 E. coli-C. pasteurianum expression vector carrying the L. lactis ltrB group II intron under control of the C. acetobutylicum ptb promoter, and ltrA ORF (ApR; ColE1 ori; ErmR; pIM13 ori) [47]
pSY6catP Derived by replacing the ermB gene of pSY6 with the catP gene from pSC12 This study
Oligonucleotide Sequence (5’-3’) *
pSC12.SOE.AS tacagcatgaccgttaaagtgg
  1. * Lower case: overlap sequences used in SOE PCR; Underline: restriction recognition sequences.