Skip to main content

Advertisement

Table 2 Primers used in this study

From: Metabolic engineering of Escherichia coli for high-specificity production of isoprenol and prenol as next generation of biofuels

Name Sequence (5′ → 3′)
HMGS-F GGAATTCCATATG AAACTCTCAACTAAACTTTG
HMGS-R CACCTCGAG TTATTTTTTAACATCGTAAGATC
tHMGR-F CATGCCATGG ACCAATTGGTGAAAACTGAAG
tHMGR-R CGGGATCC TTAGGATTTAATGCAGGTGACG
mvaS-F CCAGAGCTC AGGAGGTAAAAAAACATGACAATTGGGATTGATAAAATTA
mvaS-R CAACTGCAG TTAGTTTCGATAAGAGCGAACG
mvaE-F CATGCCATGG AGGAGGTAAAAAAACATGAAAACAGTAGTTATTATTGATGC
mvaE-R CGCGGATCC TTATTGTTTTCTTAAATCATTTAAAATAG
IDIKO-F GTCTTTTGGATCC GTTGTTAGCTC
IDIKO-R CAAAACTGCAG TTATTCCTTTGGTAGACCAGTC
phoA-F2 CTCAGATCT CCGGACACCAGAAATGCCTGTTC
phoA-R CACCTCGAG TTATTTCAGCCCCAGAGCGGC
DPP1-F2 CTCAGATCT CCAACCGTTCGAACGTCAGTTTTAC
DPP1-R CACCTCGAG TTACATACCTTCATCGGACAAAG
LPP1-F2 CTCAGATCT CGAGATATCCCTGGTACCTAGGG
LPP1-R CACCTCGAG TTACTAAACACTAACCGGTGAAGGAAG
phoE-F CTAGCCATGG GCATGACAGCCGTTTGTTTAGTAAG
phoE-R CAGGGATCC TTATTTGATAAAGCCGGATAAGTG
BsNudF-F CTAGCCATGG GCATGAAATCATTAGAAGAAAAAAC
BsNudF-F CAGGGATCC TCATTTTTGTGCTTGGAGCG
EcNudF-F CTAGCCATGG GCATGCTTAAGCCAGACAACCTG
EcNudF-F CAGGGATCC TTATGCCCACTCATTTTTTAACG
nudC-F CTAGCCATGG ATCGTATAATTGAAAAATTAG
nudC-R CAGGGATCC TCACTCATACTCTGCCCGACAC
yggV-F CTAGCCATGG GCATGCAAAAAGTTGTCCTCGCAAC
yggV-R CAGGGATCC TTAACCATTACGTAAAGCGTCC
hisl-F CTAGCCATGG GCATGTTAACAGAACAACAACGTCG
hisl-R CAGGGATCC TCACTGATGCCGTTTACGCAG
lpxH-F CTAGCCATGG CGACACTCTTTATTGCAG
lpxH-R CAGGGATCC TTAAAACGGAAAATGAATCAGCTC
ppa-F CTAGCCATGG GCATGAGCTTACTCAACGTCCCTG
ppa-R CAGGGATCC TTATTTATTCTTTGCGCGCTCG
cdh-F CTAGCCATGG GCATGAAAAAAGCGGGTCTTCT
cdh-R CAGGGATCC TTAACGCAAAATCTCACACTG
KnudF-F TCGCTGAAATTCACATTTAATTCACTATTAGTGCCAGGACATTAACAATGCATGGGAATTAGCCATGGTCC
KnudF-R TCAGGAAAGTCAGGTGTGTAACGCTTCATTTATGCCCACTCATTTTTTAATGTAGGCTGGAGCTGCTTCG
KyggV-F GCAACAAATCCCGCCAGAAATCGCGGCGTTAATTAATTAGGTATCCTATGCATGGGAATTAGCCATGGTCC
KyggV-R TGTGAATGTAGAGACTCAGCGGAGGTAATTTAACCATTACGTAAAGCGTCTGTAGGCTGGAGCTGCTTCG
KnudF-vF ACCCAGAAAGGCTCAGGCCG
KnudF-vR ACAGTTTCGCCGGGTGCGTC
KyggV-vF GACGGCCAGGCCAACAGTCA
KyggV-vR CGGCCCTGAGCGTAAGCCAC
A110G-F CTCTTTCGAAATCAAGGAAGGTTGTTACGGAGC
A110G-R CCTTCCTTGATTTCGAAAGAGCGAGCGAAAG
  1. Underlines indicate restriction enzyme sites.