Skip to main content

Table 1 Oligonucleotides used in this study

From: Mutation of the Xylanase regulator 1 causes a glucose blind hydrolase expressing phenotype in industrially used Trichoderma strains

Name Sequence (5′ - 3′) Usage
act1f TGAGAGCGGTGGTATCCACG qPCR
act1r GGTACCACCAGACATGACAATGTTG
cbh1f GATGATGACTACGCCAACATGCTG
cbh1r ACGGCACCGGGTGTGG
cbh2f CTATGCCGGACAGTTTGTGGTG
cbh2r GTCAGGCTCAATAACCAGGAGG
taqxyn2f GGTCCAACTCGGGCAACTTT
taqxyn2r CCGAGAAGTTGATGACCTTGTTC
taqxyr1f CCCATTCGGCGGAGGATCAG
taqxyr1r CGAATTCTATACAATGGGCACATGGG
sar1fw TGGATCGTCAACTGGTTCTACGA
sar1rev GCATGTGTAGCAACGTGGTCTTT
xyn1f CAGCTATTCGCCTTCCAACAC
xyn1r CAAAGTTGATGGGAGCAGAAG
FT161f GGAGGCCACTCAATCGTATGA xyr1 3′-UTR cloning
FT162r CGTGCCGCAATCCGGTTGTT
FT163f TGGGTGGTGGTATAGTCTTAAGGGAGGCCACTCAATCGTATGA
FT164r ACGGCCAGTGAATTCTTAATTAACGTGCCGCAATCCGGTTGTT
FT165f GATGTGGCAGCCGGGGAA xyr1 5′-UTR and coding sequence cloning
FT166r TTAGAGGGCCAGACCGGTTC
FT167f ACTCTAGATTAATTAAGATGTGGCAGCCGGGGAA
FT168r GCTTTCGCCACGGAGCTTTAGAGGGCCAGACCGGTTC
FT169f TGCCTGCAGGTCGACTCTAGATTAATTAAGATGTGGCAGCCGGGGAA
FT170f CGGTCTGGCCCTCTAAAGCTCCGTGGCGAAAGCCT cbh1 3′-UTR cloning
FT171r GACGAATGATGGCGGCCGCTTTCCAGGCCGCCAGCTATG