Skip to main content

Table 2 qPCR of differentially expressed genes following N deprivation

From: Molecular and cellular mechanisms of neutral lipid accumulation in diatom following nitrogen deprivation

Locus tag Forward (5’-3’) Reverse (5’-3’) FC(N/Ctr) FC Log2(N/Ctr) Z-test FDR
54257 agaatcggtgatgcctgttc atgccgctgctttagtgaat 103.3 5.80 0 0
45012 acgattcggacgaagatcag ccatgcaacaatcgtagtgg 26.0 5.56 6.71E-14 1.99E-13
27877 acaccaccgacaagaccttc tccagacagagcgtacaacg 116.6 5.46 0 0
54465 gagcacttcgttctccaagg gtccagaaagccacagcttc −17.1 −8.98 0 0
13154 caggaactcgcgaagttagg gcaagaatggaacccactgt 3.35 7.42 2.46E-5 4.37E-5
45852 aaggccacaatctcatggac cttttgacggatggcaactt 23.6 7.41 7.47E-9 1.63E-8
51183 ctttacaacgccctgatcgt ttgctgtcgtggaaagactg −15.7 −8.65 0 0
9794 gcatattggaggctttggaa tctgcatcatcatcccgata 1.35 −0.58 7.29E-3 0.010
  1. Each value corresponds to the mean of three biological sample performed in duplicates; β- actin is used as house-keeping gene in real-time quantitative PCR; significant changes are indicated by a p value<0.05 (Z-test).