Skip to main content

Table 3 Gateway compatible primers for the cloning of the putative regulatory genes

From: Screening of candidate regulators for cellulase and hemicellulase production in Trichoderma reesei and identification of a factor essential for cellulase production

Construct 5′primer 3′primer
pMH8 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCGCTCTTTGTCTGCTTGG 3GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATTGTTGCTGCCCGCCCCA
pMH9 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTACATCATGTTCTACACATGTGG 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTTCACGACGGCGGTAGAGC
pMH10 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTCGCACTAGAGCACAATGGAGAC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTGCTACTTCTGTATACACTTAATCAC
pMH11 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCCTCCAATGCCAAC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTTCATAATCAGACCAGCTCTTTC
pMH12 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGGGAGCAGCGCCA 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAGCCGTAAATCTATGTAGTTGA
pMH13 5GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGCCACGCCCAAAAGTCCACC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTATCAGAACCCAAACGCCCGCGG
pMH14 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCGTCCTCTTACGGCACTC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTGTTAGAATACTAAACTCTTCGC
pMH15 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGCTGCGCTACTCCCCCGTCT 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAGCCAACAACGGTAGTGGA
pMH16 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGACCAGCTCGGACGATTCCA 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGTGAAGGAGGGCGGTAT
pMH17 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCTGGATCGCCTGCTGCTG 3′GGGGACCACTTTGTACAAGAAAGCTGGGTACACATTCATCCCTGCGCCCAG
pMH18 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGCCTCTCGTTGTCGTCCCAG 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAATTGAGCAGCGGCTCGCG
pMH19 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGATCTGCAATCCTTTGACA 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACAGACGCTTTCCGAAAAAG
pMH20 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGGCCGGCAACCGAGACAAC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTATTATATAAACGGGGCATCAAT
pMH21 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGTTCGAGGCACCGGATC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAAGAAACATCTTCCGACCTGA
pMH22 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGTCCCGCCAAATCTCC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTCGGTGCTGATACTTCT
pMH24 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGTCGTCAAACGCTTCACCG 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGCCCAAATGGCCCATATTG
pMH25 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGACTTCTGAAGCCCCCTCTC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACTCGCCCTCTTCGCCTC
pMH26 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCCGACACCCCGACTC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAGAAGCCCGCCTGCTCTGC
pMH27 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCACAATGCCTCGCCGCGCCT 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTTCATTCATCGCCCCAGAACAA
pMH28 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGAACATGACGACAACGCT 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTCTATCTATAACTTGGTATTTTGC
pMH29 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGTAGCACATAGTCTACCCTCT 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATATCGGCACCATGTCG
pMH30 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGCTCATCAACAACCTCGATCC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTGTCAGACGAAACGCCGCCAG
pMH32 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGTTCCCGTACGGTGCC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACATACCCATAATCATTCCTC
pMH33 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGACATCAATAACGCATCCCTC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTTGCCTTCATCTCCTGGTGGAAT
pMH34 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGTTCGGACAGTACTCACTCG 3′GGGGACCACTTTGTACAAGAAAGCTGGGTATTACGACAATGGCAAGATCCT
pMH35 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGGCCAAGAAGGCGCGTC 3′GGGGACCACTTTGTACAAGAAAGCTGGGTGCTAGGCGCCGTTGACGACTC
pMH36 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGTCCAGATTCTGTCCGCT 3′GGGGACCACTTTGTACAAGAAAGCTGGGTGCATCAATAGGCCGTATCAGAG
pMH37 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTGCGCATCATGACGGCCGAGTACGAAG 3′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCGTTCATGCAGCAGCAG