Skip to main content

Table 4 Primers for the PCR screening of the overexpression strains

From: Screening of candidate regulators for cellulase and hemicellulase production in Trichoderma reesei and identification of a factor essential for cellulase production

Primer Sequence 5′- 3′
pgpdA GGCAGTAAGCGAAGGAGAATG
pMH8R1 ACACGGCTTCTTATATCTCGACC
pMH9R3 ATGGTCTCGATGTGGCTGCT
pMH10R1 CTGCGAGAGCAGCTAGGAGC
pMH11R2 CGTCGATTCGCGCTTGAACA
pMH12R2 GATGCACGCCGCCATCGAGT
pMH13R2 TCGTTCTCCTCGTAGATTCAG
pMH14R1 GCTGGCTCTTCTCCCTCACAC
pMH15R3 TGAGTATAGCGGCTGACTTGTCG
pMH16R3 CTCGTTGACTTGCAGGCCTTG
pMH17R1 CTGAGGGCTGTAGACGCACTC
pMH18R1 TTACAGAGGTGAGACTTTCCCT
pMH19R1 TTGCGTTGCGCCTTTACC
pMH20R3 TCGAGACGATGCAGCGATAG
pMH21R1 TGGTTCTGGATCACTCGTCA
pMH22R1 TTCGTCCTCCGTCTTGAGCA
pMH24R2 CTCACCTCGTCGTACACACTA
pMH25R1 ATGCGGTTGACTTGACAGAT
pMH26R2 GGTTGACTCTGGATGTTGGA
pMH27R1 ATCTTGACGTCCTTGTCGAT
pMH28R1 GCGAATCGACCAGATCGTGT
pMH29R1 GTCCTTGCACCGCTTACACG
pMH30R2 GTAGAAGCGCAATGCGGTGG
pMH32R2 CAGATGCACGTCTTCCAGAT
pMH33R1 TCTGGTCTCGATTGCTCGTG
pMH34R1 CATCAGCCTCGTCTCCAGCA
pMH35R3 CATCATCAATGTCCTCGAAG
pMH36R1 GTCAGGATAGCGCCTGTCTG
pMH37R1 GTCCGGTACAGCGTGTCAAT
  1. Primer named pgpdA was used in combination with the gene specific primers.