Skip to main content

Table 5 Primers for the quantitative PCR analysis

From: Screening of candidate regulators for cellulase and hemicellulase production in Trichoderma reesei and identification of a factor essential for cellulase production

Gene 5′ primer 3′ primer
cbh1 GCGGATCCTCTTTCTCAG ATGTTGGCGTAGTAATCATCC
cbh2 TCCTGGTTATTGAGCCTGAC GCAACATTTGGAAGGTTCAG
egl1 GTCTACTACGAACTCGAC GTAGTAGTCGTTGCTATACTG
bgl1 GCCTCCAAGATCAGCTATCC ACCTCCTCACCGATGAACTG
xyn1 AAACTACCAAACTGGCGG TTGATGGGAGCAGAAGATCC
xyn2 CGGCTACTTCTACTCGTACTG TTGATGACCTTGTTCTTGGTG
xyn3 TACAAGGGCAAGATTCGTG ACTGGCTTCCAATACCGT
axe1 TAAAGCAGCAATCTTCATGG GCAGTAAGACTTGATCTTGG
bxl1 GTCACTCTTCCAAGCTCAG ATCGTTACCTCTTCTCCCA
xyr1 GAGTATCAGCGCAACTTTAGCA CATCGGTATAGTGCAAGAAGCTC
sar1 TCTCCACCCTACTTCTGAG CTTGTTGCCCAGGATGAC