Skip to main content

Table 2 Primers used in this study

From: Deletion of meso-2,3-butanediol dehydrogenase gene bud C for enhanced D-2,3-butanediol production in Bacillus licheniformis

Primer name aSequence 5′ → 3′
ΔbudC-A-F CGCGGATCC AAAGCGCATGTTTTAAAAC
ΔbudC-A-R CCGCCCTCCATATAGAATATAATTTTAAAAATAAACATCTTCTTTCTATAAGTAA
ΔbudC-B-F ACCAATTACTTATAGAAAGAAGATGTTTATTTTTAAAATTATATTCTATATGGAG
ΔbudC-B-R GCTCTAGA CCTCGCACTAGTGTATTTTGAAAC
ΔbudC-F CGAACTCCATGAACTGACAGTC
ΔbudC-R TTGCTATTTCCTGTTATGACC
P43-budC-TamyL-1 CGCGGATCC TGTCGACGTGCATGCAGG
P43-budC-TamyL-2 CAATTTTTCCAGATACTTTACTCATGTGTACATTCCTCTCTTACCTATA
P43-budC-TamyL-3 TATAGGTAAGAGAGGAATGTACACATGAGTAAAGTATCTGGAAAAATTG
P43-budC-TamyL-4 CGTCCTCTCTGCTCTTCTATCTTTTAATTAAATACCATTCCGCCATC
P43-budC-TamyL-5 GATGGCGGAATGGTATTTAATTAAAAGATAGAAGAGCAGAGAGGACG
P43-budC-TamyL-6 CCGGAATTC GATCACCCGCGATACCGTC
ΔbudC A signal crossover-F CTTCACATGGACGATCCTAAT
ΔbudC A single crossover-R TGTTCCTCCGTAAACCGCTAAG
ΔbudC B single crossover-F CAACCACCCCTATTGAAAGCAT
ΔbudC B single crossover-R GATACCTGTCCGCCTTTCTCC
  1. aRestriction sites highlighted in bold. Italics stands for the overlap region for splicing by overlapping extension PCR (SOE-PCR).