Skip to main content

Advertisement

Table 2 Primers used for PCR a

From: Transgenic expression of delta-6 and delta-15 fatty acid desaturases enhances omega-3 polyunsaturated fatty acid accumulation in Synechocystissp. PCC6803

Primer Sequence 5′ → 3′
Delta 6-F TAAGGAATTATAACCAAATGCTAACAGCGGAAAG
Delta 6-R GTCCTGCAGTCAATGATGATGATGATGATGCGATGCTTTGCCCATGGCCT
Delta 15-F TAAGGAATTATAACCAAATGCGTCTAGAAATTTCATCG
Delta 15-R CGGCTGCAGTTACTTATCGTCGTCATCCTTGTAATCAGGTTTCTTTTGATATC
psbA2 promoter-F GATGTCGACGCTTTAGCGTTCCAGTG
psbA2 promoter-R CATTTGGTTATAAT TCCTTATGTAT
psbA2-F CTTCATATGCCGCGGATGACAACGACTCTCCAAC
psbA2-R AGTGAGCTCTTAACCGTTGACAGCAGG
  1. aText that is bold and underlined indicates restriction enzyme sites (see text for details).