Skip to main content

Table 4 DNA primers used in this study

From: Production of marker-free transgenic Jatropha curcas expressing hybrid Bacillus thuringiensis δ-endotoxin Cry1Ab/1Ac for resistance to larvae of tortrix moth (Archips micaceanus)

Primer Nucleotide sequence (5′–3′) Reference
P1 GAATTGTCGAGGTCGAAGATC [34]
P2 ATAGTGAAACAGGGGCAATGG [34]
P3 ACGGCGAGTTCTGTTAGGTC [34]
P4 GAAGATACACGGATTGAGGAGAG [34]
Hpt F AAAAAGCCTGAACTCACCGCGACGT This study
Hpt910-1 TACTTCTACACAGCCATCGGTCCA This study
Bt F1 AGGCCATACAACTGCTTGAG This study
Bt R1 CTGTAGACACCCTGACCTAG This study
Bt F2 TCATCCATCTTCTCCAATACAG This study
Bt R2 GTAACTGGAATGAACTCGAATC This study
JcActin F1 TAATGGTCCCTCTGGATGTG This study
JcActin R1 AGAAAAGAAAAGAAAAAAGCAGC This study
\