Skip to main content

Table 2 Oligonucleotides used in this study

From: A truncated form of the Carbon catabolite repressor 1 increases cellulase production in Trichoderma reesei

Name Sequence (5′ - 3′) Usage
RG53 GAATTCAGATC iv-FP, oligo-short
epiactinTr_f CTTCCCTCCTTTCCTCCCCCTCCAC act CHART, region -226 to +24
episar1Tr_f GTCAGGAAATGCCGCACAAGCAAGA sar1 CHART, region -490 to -224
epicbh1_2Tr_f GGATCGAACACACTGCTGCCTTTAC cbh1 CHART, region -301 to -27
epicbh2_2Tr_f TGCAGCGCAACACTACACGCAACAT cbh2 CHART, region -355 to -62
epixyr1_2Tr_f CCGACAGCAGCAGTAGTCAGGTTTT xyr1 CHART, region -216 to +35
  1. aItalic letters indicate a CREI-binding site (5′-SYGGRG-3′).
  2. bBold letters indicate the introduced mutation in the CREI-binding site (5′-SYTGRG-3′).