Skip to main content

Advertisement

Table 2 Oligonucleotides used in this study

From: A truncated form of the Carbon catabolite repressor 1 increases cellulase production in Trichoderma reesei

Name Sequence (5′ - 3′) Usage
RG53 GAATTCAGATC iv-FP, oligo-short
RG54 GCGGTGACCCGGGAGATCTGAATTC iv-FP, oligo-long
RG89 [6-FAM]GTAGAGGCATGTTGTGAATCTGTGTCGGG iv-FP, cbh1oligo3fw, EMSA
RG90 [6-FAM]GGTTGTATGCAAAACGCTCCGAGTCAGAC iv-FP, cbh1oligo3rev, EMSA
RG215 CCAACGGCTTGTGGGGTTGCAGAAGCAACGGCAAAGCCCCACTTCCCCACGTTTGTTTCTa EMSA
RG216 AGAAACAAACGTGGGGAAGTGGGGCTTTGCCGTTGCTTCTGCAACCCCACAAGCCGTTGG
RG221 CCAACGGCTTGT T GGGTTGCAGAAGCAACGGCAAAGCCC A ACTTCCC A ACGTTTGTTTCTb
RG222 AGAAACAAACGT T GGGAAGT T GGGCTTTGCCGTTGCTTCTGCAACCC A ACAAGCCGTTGG
RG178 TATCTCGAGTTTAGAAAAAAAAGCAGGT pGEX-cre1-RG182 construction
RG182 ATTGGATCCATGCAACGAGCACAGTCTGCCGT
RG186 TTGAGTGCAGACGTGTGTGTAATCTT Construction of QM6a-CREI96
RG187 CCCTCCTTTGTTAGAAAAAAAAGCAGGTAATGG
RG188 TTTTTTCTAACAAAGGAGGGAGACGAGGTTG
RG189 CCTACATTGGATAACGGTGAGACTAGCGGCC
RG190 TCACCGTTATCCAATGTAGGTAAGTAGTAAGGG
RG191 GAATCAGTATTTTCTCATCTCCTTG
hph3′_fw GACCTGCCTGAAACCGAACTG
hph5′_rev GAAGAAGATGTTGGCGACCTCG
actfw TGAGAGCGGTGGTATCCACG qPCR
actrev GGTACCACCAGACATGACAATGTTG
sar1fw TGGATCGTCAACTGGTTCTACGA
sar1rev GCATGTGTAGCAACGTGGTCTTT
cbh1f GATGATGACTACGCCAACATGCTG
cbh1r ACGGCACCGGGTGTGG
cbh2f CTATGCCGGACAGTTTGTGGTG
cbh2r GTCAGGCTCAATAACCAGGAGG
xyr1f CCCATTCGGCGGAGGATCAG
xyr1r CGAATTCTATACAATGGGCACATGGG
44747f GCTCGAGCTGCAAGACAAGA
44747r GCGGAGATCCATGAGCTTCT
epiactinTr_f CTTCCCTCCTTTCCTCCCCCTCCAC act CHART, region -226 to +24
epiactinTr_r GCGACAGGTGCACGTACCCTCCATT
episar1Tr_f GTCAGGAAATGCCGCACAAGCAAGA sar1 CHART, region -490 to -224
episar1Tr_r TGTGTTTTACCGCCTTGGCCTTTGG
epicbh1_2Tr_f GGATCGAACACACTGCTGCCTTTAC cbh1 CHART, region -301 to -27
epicbh1_2Tr_r GGTTTCTGTGCCTCAAAAGATGGTG
epicbh2_2Tr_f TGCAGCGCAACACTACACGCAACAT cbh2 CHART, region -355 to -62
epicbh2_2Tr_r TGCGCCTCATACAGGGTCACAGTCC
epixyr1_2Tr_f CCGACAGCAGCAGTAGTCAGGTTTT xyr1 CHART, region -216 to +35
epixyr1_2Tr_r TAGGCAGAATAGCGACGGAGAGGAT
  1. aItalic letters indicate a CREI-binding site (5′-SYGGRG-3′).
  2. bBold letters indicate the introduced mutation in the CREI-binding site (5′-SYTGRG-3′).