Skip to main content

Table 2 Oligonucleotides employed in this study

From: Expansion of the genetic toolkit for metabolic engineering of Clostridium pasteurianum: chromosomal gene disruption of the endogenous CpaAI restriction enzyme

Oligonucleotide Sequence (5′-3′)
ltrB.NheI.S CTAGC GCTATATGCGTTGATGCAATTTCTATGCACTCGTAGTAGTCTGAGAAGGCATATG
ltrB.BstAPI.AS ATGC CTTCTCAGACTACTACGAGTGCATAGAAATTGCATCAACGCATATAGCG
ltrA.XhoI.S TTTCTACTCGAG GCGTTGATGCAATTTCTATGCACTC
ltrA.BstAPI.AS GGCATCAGAGCAGATTGTACTGAG
del-Pptb.S GGG GTTAATCATTTAACATAGATAATTAAATAGTAAAAGGGAGTGTCGAGATATCC
del-Pptb.AS TCGAG GATATCTCGACACTCCCTTTTACTATTTAATTATCTATGTTAAATGATTAACCCC
MfeI/BstAPI.S AATTG ATTTAGTAATTTCTATAAGCAGGTTAGCTGTAAAACTAGCAGTAGCACGCATATG
MfeI/BstAPI.AS ATGC GTGCTACTGCTAGTTTTACAGCTAACCTGCTTATAGAAATTACTAAATC
NheI/MfeI.S CTAGC ATTTAGTAATTTCTATAAGCAGGTTAGCTGTAAAACTAGCAGTAGCACC
NheI/MfeI.AS AATTG GTGCTACTGCTAGTTTTACAGCTAACCTGCTTATAGAAATTACTAAATG
NheI/SacII.S CTAGC ATTTAGTAATTTCTATAAGCAGGTTAGCTGTAAAACTAGCAGTAGCACCCGC
NheI/SacII.AS GG GTGCTACTGCTAGTTTTACAGCTAACCTGCTTATAGAAATTACTAAATG
frag1.BglII.S GGGATATGATATACGAGTAAGGAGATCT GG
frag1.EcoO109I.AS AGTATTAGGCCCT GACGTCCCACATAATTCACAACATTTAGC
frag2.BglII.S AACAGGAGATCT GCTAAATGTTGTGAATTATGTGGGACGTC
frag2.EcoO109I.AS TACTCTAGGCCCT GGAGACCCCACACTACCATCG
frag3.BglII.S TCGCCAAGATCT CGATGGTAGTGTGGGGTCTCC
frag3.EcoO109I.AS GTGCCACCTGACGTCTAAGAAACC
3′SOE.S TGGGAAATGGCAATGATAGCGAAAC
SOE.EcoO109I.AS ATAGGCGTATCACGAGGCCCT TTC
gBlock.BglII.S CGAGTAAGGAGATCT GGAACGATAAAACG
CpaAII-anneal.S CTAGA GTCGACGTCACGCGTCCAAGGAGATCTCCAGGCCTGCAGACATGCA
CpaAII-anneal.AS AGCTT GCATGTCTGCAGGCCTGGAGATCTCCTTGGACGCGTGACGTCGACT
SYCP.gBlock.S GGAGGTCAATCTATGAAAATGCGATTAAGC
SYCP.gBlock.AS CTTTCGTTTCGTTCCCATAGGTTCTCC
MTLCP.REN-HindIII.S GTATTTAAAGCTT ATAATTATCCTTAAATTTCTTAAAAGTGCGCC
REN.Fw CTACTTGAGGTCTAGGACTTCTATCT
REN.Rv ACAGATAGGCCATTAAAGGTATTCA
ltrB.Fw CCAACGCGTCGCCACGTAATAAAT
ltrB.Rv ATGGGAACGAAACGAAAGCGATGC
  1. Italics: relevant restriction endonuclease recognition sequences.