Skip to main content

Advertisement

Table 2 PCR oligonucleotides

From: Engineering a Streptomyces coelicolor biosynthesis pathway into Escherichia coli for high yield triglyceride production

Name Sequence (5′-3′) Reference
dgkA_F AGGATCTGCCGGAATAGACTTGCTT This study
dgkA_R AGCGCCTTCAGATGTTCTTCAGCC This study
fadE_F CAAAAGCGAGAAGTACGGGCAGGTG This study
fadE_R GCTTTCGATTGATGGTAAAACGGTG This study
araBAD_F CTCGATTTTGGCAGTGATTCTGTGCGAGCTTTGGCGGTGGCTGTCAAACATGAGAATTAA This study
araBAD _R CCGTAATATGCCTTCGCGCCATGCTTACGCAGATAGTGTTGTGTAGGCTGGAGCTGCTTC This study
ara_check_F TAAACGAGTATCCCGGCAGCAGGGG This study
ara_check _R CGGGAATAAACGCCACGGACTCTTG This study
araA_wt_F AAGTGTATTACGGGTTTCGTCGCTA This study
atfA_F CATATG CGCCCATTACATCCGATTG This study
atfA_R ACTAGT CCTTTAGTTTTATCTGATA This study
fadD_F GCTAGC AAGAAGGTTTGGCTTAACC This study
fadD_R ACTAGT CTCAGGCTTTATTGTCCAC This study
gpsA_F CATATG AGCAAGCCGGTCAAGGCGG This study
gpsA_R ACTAGT GCGGGTTGCGCGGGGGGTC This study
fadR_F CATATG GTCATTAAGGCGCAAAGCC This study
fadR_R ACTAGT ATGGGAAATCTGTAAAAAC This study
accB_F CATATG ACCGTTTTGGATGAGGCGC This study
accB_R ACTAGT TCACTGCGGCGGGTTGCCG This study
accE_F CATATG TCCCCTGCCGACATCCGCG This study
accE_R ACTAGT TCAGCGCCAGCTGTGCGGG This study
  1. Restriction sites are shown in italics. Homologous sequences to pKD13 plasmid are shown in bold.