Skip to main content

Advertisement

Table 1 Conditions and primers for hiTAIL-PCR

From: An acidic, thermostable exochitinase with β-N-acetylglucosaminidase activity from Paenibacillus barengoltzii converting chitin to N-acetyl glucosamine

Reaction Numbers of cycles Thermal settings
Primary 1 93°C 1 min, 95°C 1 min
  5 94°C 1 min, 60°C 1 min, 72°C 1.5 min
  1 94°C 1 min, 25°C 3 min, ramping to 72°C in 3 min
  15 94°C 30 s, 63°C 1 min, 72°C 2.5 min
   94°C 30 s, 63°C 1 min, 72°C 2.5 min
   94°C 30 s, 44°C 1 min, 72°C 2.5 min
  1 72°C 8 min, 4°C forever
Secondary 12 94°C 30 s, 63°C 1 min, 72°C 2.5 min
   94°C 30 s, 63°C 1 min, 72°C 2.5 min
   94°C 30 s, 44°C 1 min, 72°C 2.5 min
  1 72°C 8 min, 4°C forever
Tertiary 20 94°C 30 s, 63°C 1 min, 72°C 2.5 min
   94°C 30 s, 63°C 1 min, 72°C 2.5 min
   94°C 30 s, 44°C 1 min, 72°C 2.5 min
  1 72°C 8 min, 4°C forever
Primers Size (bp) Sequencesa
AD1 15 5' NTCGASTWTSGWGTT3'
AD2 16 5' NGTCGASWGANAWGAA3'
AD3 16 5' WGTGNAGWANCANAGA3'
dSP1 24 5' ATTGGGAACGACGCTGCCGTTATA 3'
dSP2 24 5' ACGGAATACCCATGACGATTTTGG3'
dSP3 24 5' CTGGCGTTGTGATTCGTGGTTTGT 3'
uSP1 24 5' CGGCTTCCAAAATCGTCATGGGTA 3'
uSP2 24 5' TATAACGGCAGCGTCGTTCCCAAT 3'
uSP3 24 5' CAGCCGCGTACGTGAACAAAAATG 3'
uSP4 24 5' CAGCTCCGGCCAATCTGAGGGTAA 3'
uSP5 24 5' ATCAAGGGGATGCGCTCGCAGACA 3'
uSP6 24 5' CGGAAACCTTTCACCTGCCAGCAA 3'
  1. aN = A/G/C/T, S = C/G, W = A/T.