Skip to main content

Table 1 List of C. butyricum CWBI 1009-specific primers and probes used in this study

From: Genome-wide transcriptional analysis suggests hydrogenase- and nitrogenase-mediated hydrogen production in Clostridium butyricum CWBI 1009

Target gene Primer/probe Sequence 5’ → 3’ Length (bp) Ref.
recA RecA-ButF AAGCATTAGTGCGTTCTGGAG 97 [41]
RecA-ButR GAATCTCCCATTTCCCCTTC
hydA2 ButA2F ATAGTTGCAATGGCTCCTGC 250 This study
ButA2R TTTCTGCTTGCCTAACCCAT
hydA8 ButA8F TCTTTGGAGTTACAGGGGGA 188 This study
ButA8R TTCAGCATTTGCAAGACCAC
hydB2 ButB2F TGGTGGTGTATCAACTGCTG 168 This study
ButB2R TTGCATCCCATTCCTTCAAT
hydB3 ButB3F CAATGGTTGCTACAGGCAGA 168 This study
ButB3R CAAAAGCATCGAATAACGCA
16S rRNA 16SButF CCTGCCTCATAGAGGGGAAT 143 This study
16SButR GAGCCGTTACCTCACCAACT
HP16SButa CCGCATAAGATTGTAGTACCGCATGGTACA
nifH NifHButF CATCAGCATTGGCTGAGATG 206 This study
NifHButR TGGTTCTGGTCCTCCTGATT
  1. aHP: hydrolysis probe.