Skip to main content

Table 3 Genes and primer sequences used for real-time PCR

From: Transcriptomic analysis revealed the mechanism of oil dynamic accumulation during developing Siberian apricot (Prunus sibirica L.) seed kernels for the development of woody biodiesel

Abbreviation Gene name Accession number Primer forward Primer reverse Amplicon size (bp)
accC Acetyl-CoA carboxylase. biotin carboxylase subunit KM364594 CCAGGAAGAATAACCGCCTAC GGGAGTCATAGTTTGGAGGAAC 100
dgat1 Diacylglycerol acyltransferase 1 KM364597 CAGCCTATGTGTCTGCTTCTAT CTCGATCCACACCTTGAGATT 98
pdat2 Phospholipid:diacylglycerol acyltransferase 2 KM364598 TGATGACAGTGTGCCTGTATTG CTTGTGCTGGTACTCCCTTATG 115