Skip to main content

Table 3 List of primers used in the real-time PCR analysis

From: Enzyme activity highlights the importance of the oxidative pentose phosphate pathway in lipid accumulation and growth of Phaeodactylum tricornutum under CO2 concentration

Primers Sequence (5′–3′) Annealing temperature (°C) Amplicon size (bp)
RPS (ribosomal protein small subunit 30S) Sense: CGAAGTCAACCAGGAAACCAA 56 166
Antisense: GTGCAAGAGACCGGACATACC
TBP (TATA box binding protein) Sense: ACCGGAGTCAAGAGCACACAC 56 175
Antisense: CGGAATGCGCGTATACCAGT
Rubisco (rbc S) Sense: ACTCTGCTGGTGCTGTGCG 56 214
Antisense: TGGGATTGGCGTCGTTCTT
PRK Sense: GAAGTTTGCTGTCTTTGCCTCT 56 139
Antisense: GATGGGTGTCTGTCCCTCCT
PGK Sense: TGGTGGTGGCGACTCTGT 56 156
Antisense: TACGCATTCCCGGCTTAC
G6PDH Sense: GCGAGAAATGGCACAAGG 56 180
Antisense: GTTCATCGCAGTCGGGAGA
6PGDH Sense: GTTCACCGTTGCCGTTTG 56 143
Antisense: CGACTTTCCGAGGCTTGCTG