Skip to main content

Table 3 List of PCR primers used in this study

From: Construction of a self-cloning system in the unicellular green alga Pseudochoricystis ellipsoidea

Primer name Sequence (5′ to 3′) Target
Umps_F CCACAAAACCCATTGCCTCAACA 5′-end of UMPS
Umps_R TCCGTGCTGTCTTCCAGGTCTT 3′-end of UMPS
Umps_cDNAF CCAAGCTTTGCATGGCATTCAACAAGGTGAA 5′-end of UMPS cDNA
Umps_cDNAR GGAATTCCCAACCTCATTTGAGAGGCAAT 3′-end of UMPS cDNA
Umps_CDRF CACCCATGGCAACTTCAACTCCCTCAGT 5′-end of UMPS CDR
Umps_CDRR CACAAGCTTCATGCCAGCGTGGCCTCATA 3′-end of UMPS CDR
Ptub_F CCAAGCTTTGCATGGCATTCAACAAGGTGAA TUBULIN1 promoter
Ptub_R_Umps5′ GAGTTGAAGTTGCCATCTTGAACGACTTCCCTCGACAA 5′-end of UMPS CDR and 3′-end of TUBULIN promoter
Umps3′_Tact_F GCCACGCTGGCATGAGGTGAGCCTGAAACAGCTTTCTG 3′-end of UMPS CDR and 5′-end of ACT1 terminator
Tact_R TCGGTACCGGTTGTTGAGTTGAGCACTGGAC 3′-end of ACT1 terminator
Tact_R2 CCCCAGCTGCTACTGCTATC A middle part of ACT1 terminator
Prbc_F CTCAATCGGCCGATTTCATGCATGA 5′-end of RBCS promoter
Trbc_R GTGCTGGTCTGTTTCCATGCAGTCAT 3′-end of RBCS terminator
Ptub3′_Umps_CDRF GGGAAGTCGTTCAAGATGGCAACTTCAACTCCCTCAG 3′-end of TUBULIN promoter and 5′-end of UMPS CDR
Umps_CDRR_Tact5′ TGTTTCAGGCTCACCTCATGCCAGCGTGGCCTCATA 5′-end of ACT1 terminator and 3′-end of UMPS CDR
G418F GATCGGCCATTGAACAAGAT nptII
G418R GCGATACCGTAAAGCACGAG nptII
Umps_QRT_F TCTTCGACAAGTGGGATGATGG Position 908–930 of UMPS CDR
Umps_QRT_R TGTTACCGATGTCCGCAAAC Position 993–1012 of UMPS CDR
18SrRNA_QRT_F GGATCAATTGGAGGGCAAGT Position 627–646 of 18S rRNA
18SrRNA_QRT_R GCCCGAAATCCAACTACGAG Position 713–732 of 18S rRNA