Skip to main content

Table 7 The sequences of the oligonucleotide primers used in this study

From: Development of cellobiose-degrading ability in Yarrowia lipolytica strain by overexpression of endogenous genes

Primer names Sequence (5′–3′) restriction sites are italic/underlined Restriction sites
FA1 CGa GGATCCCGCGATGATCTTCTCTCTGCAACTACTAC BamHI
RB1 CGCCTAGGCTACAAAGTGAAAGTCTCACATAGC AvrII
FA2 CCCAAGCTTGGGTTTGGAGGGGGTGAAAAA HindIII
RB2 CCCAAGCTTGGGCTAAAGACCTAACCAATTCTTAGTCT HindIII
FA3 CGGGATCCCGCGATGATTGCAAAAATACCCC BamHI
RB3 CGCCTAGGCTACTGGAGAGTAAAGGACTCG AvrII
FA4 CGGGATCCCGCGATGCTCGCATTCGTCCTAC BamHI
RB4 CGGGATCCCGCTACTTGAGAGTGAAGCTGGTG BamHI
FA5 CGGGATCCCGCGATGGCTCCACCCCCGCCTCCT BamHI
RB5 CGCCTAGGTTAAGCAATCGTGATGCGACCAAGG AvrII
FA6 CGCCTAGGCGCGATGGAGGAATTATCGGAGGC AvrII
RB6 CGCCTAGGCTACCGGCTGAACTTCTCTTC AvrII
RB-His1 b CGCCTAGGTTAATGATGGTGATGATGGTGGCTGCCGCGCGGCACCAGCCTAGGCAAAGTGAAAGTCTCA  
RB-His2 CCCAAGCTTGGGTTAATGATGGTGATGATGGTGGCTGCCGCGCGGCACCAGCCTAGGAAGACCTAACCAATTCTTA  
RB-His3 CGCCTAGGTTAATGATGGTGATGATGGTGGCTGCCGCGCGGCACCAGCCTAGGCTGGAGAGTAAAGGA  
RB-His4 CGGGATCCCGTTAATGATGGTGATGATGGTGGCTGCCGCGCGGCACCAGCCTAGGCTTGAGAGTGAAGCT  
RB-His5 CGCCTAGGTTAATGATGGTGATGATGGTGGCTGCCGCGCGGCACCAGCCTAGGAGCAATCGTGATGC  
RB-His6 CGCCTAGGTTAATGATGGTGATGATGGTGGCTGCCGCGCGGCACCAGCCTAGGCTGAACTTCTCTTCC  
  1. aRestriction site with corresponding restriction enzyme.
  2. bHis-tag introduced into the corresponding genes.