Skip to main content

Advertisement

Table 2 Primers used in construction of the gcd knockout strain of A. baylyi ADP1

From: Metabolic engineering of Acinetobacter baylyi ADP1 for removal of Clostridium butyricum growth inhibitors produced from lignocellulosic hydrolysates

Primer Sequence (5’ → 3’)
U1 GTTTCTTCGGTACCGCTTCTCTCGAATCAACCTAAATG
U2 GTTTCTTCCAATTGGAGACCACCTCGAATAATTTG
D1 GTTTCTTCCCTAGGGCATTGCCGGATACCAAATAATC
D2 GTTTCTTCGGCCCCCGAGGCCCATCGGTGCATAACGCTGTAC
C1 GCTTCTCTCGAATCAACCTAAATG
C2 CATCGGTGCATAACGCTGTAC