Skip to main content

Advertisement

Table 5 List of the primer pair used in this work

From: Aspergillus nidulans protein kinase A plays an important role in cellulase production

Primer Sequence
pRS426-5′ PKA UTR F TAACGCCAGGGTTTTCCCAGTCACGACGTTCTGAAGCCCGATACAACC
PKA Spacer GFP R AAAGTTCTTCTCCTTTACTCATTCCCCGTGTTCCGAAATCGGGGAACAGGTGACCG
PyrG 3 UTR PKA F AAGAGCATTGTTTGAGGCGAATTCACCCTCTAACGAGTGATG
PKA 3 UTR-pRS426 R GCGGTTAACAATTTCTCTCTGGAAACAGCTCTAAGGCAGGCAGTTCTCG
GFP PyrG FW GCATGCAAGCTTGGCGTATTCTGTCTGAGAGGAGGC
Afu PyrG RV FGSC GAGCAGCGTAGATGCCTCGACC
Spacer GFP FW GGAACACGGGGAATGAGTAAAGGAGAAGAACT
GFP Ve 3 Afu RV CTCAGACAGAATACGCCAAGCTTG
pRS426-5′ snfA UTR F GTAACGCCAGGGTTTTCCCAGTCACGACGTGGAGATGGAAGTCGAAAGG
CreA GFP ATAGACATGCCGTCACATGG
Afu pyrG pCDS60 R GAGCAGCGTAGATGCCTCGACC
F_pkA_checkinsert_A ATGGGTCCGACACCAAGA