Skip to main content

Advertisement

Table 1 Sequence variants from sequenced wild-type Cpa 6013 vs. M150B

From: Whole-genome sequence of an evolved Clostridium pasteurianum strain reveals Spo0A deficiency responsible for increased butanol production and superior growth

Mut. locus [20] Mut. type CDS Mut. Ref. Var.
135360 Sub. No CDS   A G
177873 Sub. Hypothetical cell wall-binding protein, c01710 A267V C T
256066 Sub. Glycosyltransferase, c02430 I257T A G
328268 Sub. Xanthine dehydrogenase, molybdenum binding; pudD1 P483L C T
511135 Sub. Pyridine nucleotide-disulfide oxidoreductase; NADH dehydrogenase; coenzyme A disulfide reductase; c04890 P187S T C
547010 Sub. Pyruvate-flavodoxin oxidoreductase; nifJ1 S579N+ G A
609918 Sub. Lactose permease; lacS P429S G A
623217 Sub. lysin; c05770 A129T G A
633860 Sub. Hypothetical protein; c05850 Silent C T
662676 Sub. High-affinity nickel-transport protein; nixA1 Silent C T
664502 Sub. Methyl-accepting chemotaxis protein; c06130 T311A A G
774540 Sub. Metallophosphoesterase; c07050 G294E G A
805746 Sub. Putative amidase domain-containing protein; c07320 G378E G A
822080 Sub. tRN Glu)-specific nuclease WapA; wapA1 S1026F C T
849186 Sub. Putative glycosyltransferase; c07760 Q641tag G A
888969 Sub. Phage infection protein; c08050 E95K+ C T
905016 Sub. putative L-ascorbate-6-phosphate lactonase UlaG; ulaG A128V C T
959280 Sub. No CDS   C T
1010600 Sub. Radical SAM domain protein; c09370 G32D C T
1018923 Sub. No CDS   G A
1034853 Sub. Putative AAA-ATPase; c09620 E311K+ G A
1047038 Sub. DNA-binding response regulator; c09780 Silent G A
1052341 Sub. Hypothetical protein; c09830 E98K+ G A
1058795 Sub. Nicotinamidase; c09830 V31I+ G A
1263298 Sub. No CDS   G A
1384612 Sub. Spore germination protein KA; gerKA2 G15D G A
1408727 Sub. hypothetical protein; c13080 L71N G A
1595471 Sub. Lactate-responsive regulator LldR; c14940 A154T G A
1597713 Sub. Electron transfer flavoprotein, alpha subunit; etfA1 A300T G A
1608597 Sub. CAAX amino terminal protease family protein; c15040 Silent T C
1729728 Sub. Integral membrane protein; c16180 V8I+ G A
1796914 Sub. Phenylalanyl-tRNA synthetase beta chain; pheT A674V C T
1957368 Sub. Flagellum-specific ATP synthase FliI; fliI E44K+ G A
1973896 Sub. RNA polymerase sigma factor for flagellar operon; whiG A75T G A
1976216 Sub. Flagellar basal-body rod protein; flgG3 Silent T C
2055679 Del. Stage 0 sporulation protein A; spo0A Del. 235–242 ATACCATAAATAAATTATTTGGAT  
2822361 Sub. CRISPR-associated helicase/endonuclease Cas3; cas3 E316F C T
3198907 Sub. No CDS   C T
3208358 Sub. Exonuclease SbcC; sbcC A558T C T
3222314 Sub. Hypothetical protein, CF-17 family; c29890 E213K+ C T
3270753 Sub. No CDS   C T
3272757 Sub. tRNA-dihydrouridine synthase; c30410 D126K+ C T
3273913 Sub. Fe-S oxidoreductase; c30430 T87A A G
3297381 Sub. No CDS   G A
3348577 Sub. Transcriptional regulator, TetR family; c31160 S20N+ C T
3399757 Sub. Hydrolase (HAD superfamily); c31590 P219S G A
3439637 Sub. Multiple sugar transporter, membrane-spanning permease protein MsmG; msmG2 A236V G A
3488562 Sub. Potassium-transporting ATPase C chain; kdpC T283I G A
3497476 Sub. Fatty-acid peroxygenase; cypC P255S G A
3521979 Sub. ATP phosphoribosyltransferase regulatory subunit; hisZ P96L G A
3531067 Sub. Cysteine desulfurase; c32790 Silent G A
3535341 Sub. Chaperone protein HtpG; htpG Silent G A
3593919 Sub. No CDS   G A
3595710 Sub. 2-iminoacetate synthase; thiH2 P77S G A
3641811 Sub. Possible surface protein; c33730 T742I G A
3666696 Sub. No CDS   G A
3698846 Sub. L-arabinose transport system permease; araQ2 T235I G A
3759007 Sub. hypothetical protein; c34910 E729K+ C T
3776313 Sub. RNA-binding protein; c35120 S523N+ C T
3863797 Sub. DNA-3-methyladenine glycosylase II; c35950 E119K+ C T
3872706 Sub. Autoinducer 2 sensor kinase/phosphatase LuxQ; luxQ3 E242F C T
3909641 Sub. Signal-transduction and transcriptional-control protein; stc3 A657V+ C T
3935380 Sub. 50S ribosomal protein L2; rplB Silent C T
3936650 Sub. 50S ribosomal protein L3; rplC G191D C T
4163498 Sub. Signal transduction histidine kinase; c39070 S439N C T
4231311 Sub. Putative competence-damage inducible protein; cinA Silent C T
  1. Positive substitutions are indicated by a plus symbol