Skip to main content

Table 2 Primers used in this study

From: Transcriptional profiling reveals molecular basis and novel genetic targets for improved resistance to multiple fermentation inhibitors in Saccharomyces cerevisiae

Target Primer sequence
WHI2 Forward GCCGGATCCAAAAATGGACGATATAATCACGCAAG
Reverse GCCGTCGACTCACTGCACCCCAATAACGC
SFP1 Forward GCCCCCGGGATGGATTTTACAACAATGACTATG
Reverse GCCGTCGACTTAGTGAGTGGAGTGGCCCC
ACE2 Forward GCCACTAGTATGGATAACGTTGTAGATCCGTG
Reverse GCCGTCGACTCAGAGAGCATCAGTTTCGTTTG
T3 promoter AATTAACCCTCACTAAAGGG
T7 promoter TAATACGACTCACTATAGGG