Skip to main content

Table 4 Oligonucleotides used for PCR amplifications

From: Construction of a restriction-less, marker-less mutant useful for functional genomic and metabolic engineering of the biofuel producer Clostridium acetobutylicum

Primer name Oligonucleotide sequence
PKD4.1 ctggcgccctgagtgcttgcggcagcgtgagggg
PKD4.2 agcccggggatctcatgctggagttcttcgccc
FRT-MLSR-F tacaggccttgagcgattgtgtaggctggagc
FRT-MLSR-R aacaggcctgggatgtaacgcactgagaagccc
PCONSAccI ccggggtaccgtcgacctgcagcc
PCONSEcoRI gaattccgcgagctcggtacccggc
ORI3-D ccatcgatgggggtcatgcatcaatactatcccc
ORI4-R gcttccctgttttaatacctttcgg
FLP1-D aaaaggatccaaaaggagggattaaaatgccacaatttggtatattatgtaaaacaccacct
FLP1-R aaatggcgccgcgtacttatatgcgtctatttatgtaggatgaaaggta
REP-UPP-F aaaacagctgggaggaatgaaataatgagtaaagttacac
REP-UPP-R aaaacagctgttattttgtaccgaataatctatctccagc
CAC 1 aaaggatccatgcacactcataaatttactgtaggaagtctg
CAC 2 ggggaggcctaaaaaggggggtcccaaataatatttgccatagtaaccacc
CAC 3 ccccctttttaggcctcccctcgaacttattagaatgattaagattccgg
CAC 4 aaaggatcctcattaaatttcctccattttaagcctgtc
CAC 0 gtgatataattttcctttaaatggaggaggatctg
CAC 5 gccgttaatagacattataattccattggc
CAC-D gaattcttaaaaatatttggatcattaagcgg
CAC-R gttgtattggaatctttgttattatttctccc
UPP 1 aaaaggatcctcctgatctattaattcttgatgaaccc
UPP 2 ggggaggcctaaaaagggggattgcataaataaaaagggctgaaaaataaatttcag
UPP 3 ccccctttttaggcctccccttatttcattcctccattgtattttttttctatttg
UPP 4 aaaaggatccgctattatgaataggttaaataagtcagctgg
UPP 0 aatacaagcaaagagaataggctatgtgcc
UPP 5 aatacaagcaaagagaataggctatgtgcc
UPP-D ggcatatgaagtaacaagagaaatgcagc
UPP-R ataatctatctccagcatctccaagacc
RM3535 1 aaaaggatccgcagctttctggaaggactacggcg
RM3535 2 ggggaggcctaaaaagggggcatttacttatggtacggttcacccc
RM3535 3 ccccctttttaggcctccccgtctttaaaaagtaatttatcaaaggcatcaaggc
RM3535 4 aaaaggatccctaactctctaaacgttacaatagtaatgcgc
RM3535 0 cacattgtcatttataaaagtccctaggg
RM3535 5 gtagtaattccaacttcaactcttgccac
RM3535-D cttagaatagctgatattgcttgcgg
RM3535-R agcatctctcttaatgattctccgg
CTF1 aaaaggatcccagacactataatagctttaggtggtacccc
CTF2 ggggaggcctaaaaagggggattataaaaagtagttgaaatatgaaggtttaaggttg
CTF3 ccccctttttaggcctccccatatccaatgaacttagacccatggctg
CTF4 aaaaggatccgtgttataatgtaaatataaataaataggactagaggcg
CTF0 taccaccttctttcacgcttggctgcgg
CTF5 tatttaaagaggcattatcaccagagcg
LDH1 aaaaggatccgctttaaaatttggaaagaggaagttgtg
LDH2 ggggaggcctaaaaagggggttagaaatctttaaaaatttctctatagagcccatc
LDH3 ccccctttttaggcctccccggtaaaagacctaaactccaagggtggaggctaggtc
LDH4 aaaaggatcccccattgtggagaatattccaaagaagaaaataattgc
LDH0 cagaaggcaagaatgtattaagcggaaatgc
LDH5 cttcccattatagctcttattcacattaagc
Cac3535-d-SpeI aaaactagtatgaatgatattaaaatagctttgaaaaaattggttgac
Cac3535-R-BamHI aaaaggatccctacaaattatatatatctgttaccaatgcctc
  1. Restriction sites are in italic