Skip to main content

Table 3 Primers, standard curve parameters and number of gene copies ml−1 sample of the investigated genera

From: Biomethane potential of industrial paper wastes and investigation of the methanogenic communities involved

  Methanosarcina Methanobrevibacter Methanoculleus Methanosphaera
F primer 240F (CCTATCAGGTAGTAGTGGGTGTAAT) 210F (TTTCGCCTAAGGATGGGTCT) 298F (GGAGCAAGAGCCCGGAGT) 594F (TAAGTCTTTGGTGAAAGCTT)
R primer 589R (CCCGGAGGACTGACCAAA) 367R (CGATTTCTCACATTGCGGAG) 586R (CCAAGAGACTTAACAACCCA) 747R (GTTACTCACCGTCAAGAT)
R 2 value 0.9999 0.9993 0.9999 0.9994
Slope −4.53 −3.958 −4.679 -4.358
Intersept 38.913 35.106 43.209 38.283
Efficiency 0.66 0.79 0.64 0.70
CS 5.80E+07 (3.24E+06) a 2.99E+07 (3.98E+06) a 1.98E+06 (8.95E+05) a 2.31E+06 (2.90E+05) a
WR37 2.39E+08 (2.98E+07) ab 2.13E+07 (3.29E+06) ab 4.63E+06 (9.85E+05) ab 2.95E+06 (7.85E+05) ab
WR55 2.48E+07 (4.53E+06) b 1.21E+07 (1.90E+06) b 9.51E+06 (1.74E+06) b 7.66E+05 (1.98E+05) b
PR37 2.03E+08 (1.71E+07) a 2.62E+07 (2.55E+06) a 1.04E+07 (1.63E+06) a 2.91E+06 (6.09E+05) a
PR55 4.75E+07 (3.28E+06) b 1.21E+07 (1.28E+06) b 1.95E+07 (6.18E+06) b 7.83E+05 (1.51E+04) b
WR37us+en 1.67E+08 (2.06E+07) b 2.09E+07 (3.56E+06) ab 7.23E+06 (5.46E+05) ab 2.11E+06 (1.23E+05) ab
PR37us+en 1.54E+08 (1.85E+07) ab 3.40E+07 (4.48E+06) a 1.12E+07 (2.98E+06) a 7.15E+05 (9.79E+04) a
  1. n = 6; standard error is given in brackets. Different letters indicate significant differences between pretreatments (p < 0.05) according to the Tukey HSD test
  2. CS cattle slurry, WR wood residues, PR pulp residues, 37 anaerobic digestion at 37 °C, 55 anaerobic digestion at 55 °C, us ultrasound pretreatment, en enzyme pretreatment