Skip to main content

Table 2 Primers used in quantitative, touch down and standard PCR targeting the fhs gene

From: Bacterial community composition and fhs profiles of low- and high-ammonia biogas digesters reveal novel syntrophic acetate-oxidising bacteria

Primer name Nucleotide sequence (5′–3) Annealing temperature (°C)
OTU3 fw
OTU3 rev
TTTGAACCAGCTGGGGAAA
TTAGCTCGCATTGTTGTCG
63
OTU4 fw
OTU4 rev
GTTGAGGAAAATCGGRAAA
CTATCCAATATTATCATTG
55
OTU5 fw
OTU5 rev
CATACGTGAGCCTTCCCTGG
CCGCAAACGATATTCCGCAG
63
OTU6 fw
OTU6 rev
ATTACATAGCTTAGGCAAA
CCACCACAATATTGCCAAG
53
OTU7 fw AGAGAACCATCTTTAGGGCCA 63
OTU7 rev TGGTTTTCCACCAAGACCCA 63
OTU8 fw
OTU8 rev
GAGAATTGGCAAGAAGGCCA
CTGCCTCCCAGACCAACTAC
63
OTU9 fw
OTU9 rev
CCTGGGCAAGCTGGACAAG
GTGGGCAAAATCTTGGTTG
63
OTU10 fw
OTU10 rev
TTTGCGAAAATTAAATAAG
ATTAACCGGATTGTCATTG
55