Skip to main content

Advertisement

Table 2 List of primers used

From: A markerless gene deletion and integration system for Thermoanaerobacter ethanolicus

Name Sequence
p1 GAGAAAGGCGGACAGGTA
p2 AATTCTCTTACTGTCATGCC
p3 TGCCTCCTCATCCTCTTC
p4, p14 TTAACCTATAAAAATAGGCGTATCACGAGATGCATCAGCGCCCTGAAGAAGTAACTGACA
p5 CCACCTATATCGGTTTTCTTCATCTCTACACCTCTTTTAGTCTTCACCACTCTAACCCCC
p6 AAAAGAGGTGTAGAGATGAAGAAAACC
p7, p17 CTCCCCGCGCGTTGGCCGATTCATTAATGATGCATCAGGCAGTTCCGCTTCAAGTTTAGG
p8 GACATTAACCTATAAAAATAGGCGTATCACGAGATGCATCAGTGCCGCCTTGTACAGTTT
p9 TTTTCACACTGTGACTTTTTATATGCAAAAAAGAGGGTTTCCACCGACAAATCCAGAGCC
p10 GGAAACCCTCTTTTTTGCAT
p11 ATCTTACCTATCACCTCAAATGGTTCGCTGGGTTTTACGCAGCGAACTTCCCGTAGCAAT
p12 CTAATCTTTTCTGAAGTACATCCGCAACTGTCCATACTCCAGTTGATATAAGCCACGGGG
p13 CCGCGCGTTGGCCGATTCATTAATGATGCATCAGCCTCTTATATGTCAAGCTCTTGTATT
p15 TACCTATCACCTCAAATGGTTCGCTGGGTTTTACGCAGGCAGTTCCGCTTCAAGTTTAGG
p16 TCTGAAGTACATCCGCAACTGTCCATACTCCAGAAAAGAGGTGTAGAGATGAAGAAAACC
p18 AGAAGAATTGGAGGCCAT
p19 CTGCAGAATAAGTAAGGCT
p20 TGCCGCCTTGTACAGTTT (binding sites the same as p8)
p21 CGAACTTCCCGTAGCAAT (binding sites the same as p11)
  1. Note: primer-binding regions are highlighted in italic fonts