Skip to main content

Table 2 genes and primers for quantitative real-time PCR

From: A water-forming NADH oxidase regulates metabolism in anaerobic fermentation

Gene ID Gene name Primer sequences
YFL039C ACT1 (reference gene) F: TGGATTCCGGTGATGGTGTT
R: TGGCGTGAGGTAGAGAGAAACC
L196579 noxE F: TCAAAAATGGCGCAATCAAG
R: CCGCGTAAACATCTGGATCA
YMR169C ALD3 F: TGGCGGCTCAGTATTGGAA
R: CGCATTCTAGTGTGATATCCTTAAGG
YPL061W ALD6 F: GACAAAGTCAACGGTAGAACAATCA
R: GGCTCTAAGGTGGTGAAGTTCATG
YOL086C ADH1 F: GAAGGTGCCGGTGTCGTT
R: ACCGATCTTCCAGCCCTTAAC
YDL022W GPD1 F: TCAATTTTTGCCCCGTATCTG
R: GATAGCTCTGACGTGTGAATCAACA
YHL032C GUT1 F: GCCCCAGCTCGTGAAACA
R: GGGCTTTCCGCTGGTTTT
YJR009C TDH2 F: TCCAAGAAAGAGACCCAGCTAACT
R: GGAGTCAATGGCGATGTCAA
YDR343C HXT6 F: CGCTGCTATTGCAGAGCAAAC
R: CGAGTGGGAGGCTGAGTCA
CA_C0279 Housekeeping gene F: AGAAGTGGGAGCACCTGTAAAAA
R: CGGTTCAATCTTTCCTTCAACTTT
L196579 noxE F: TCAAAAATGGCGCAATCAAG
R: CCGCGTAAACATCTGGATCA
CA_C1742 Pta F: GAAATTCAGACCGGATCTTGCT
R: GCCGCTACTTCACTATCTATTGCA
CA_C1743 AskA F: CAATGGATATAAGTGCAGAAGGTTCTA
R: CTTTGGTATCCCTTGCAATCATTA
CA_P0163 CtfA F: CAACCCAGATACTGGCAAAAAAC
R: TGCACGTATTCTTTCCACTAGAGTTC
CA_P0165 Adc F: ACGCTATGGCGCCACTTAAT
R: TGCAAGAATGTGAGAGCTAGAAACA
CA_C3075 Buk F: GGCGGACTCTTAAAGCCAATAGTA
R: GCATGCTGACCTTGAACTCCTA
CA_C3076 Ptb F: CAACACTTGATGCAGCAATGC
R: GCTAAAGGTCCGTCAACTACACAA
CA_P0035 adhE F: AGGGAGCAAGCGGAGATTTAT
R: TGCCGCATCCAAGAGTAAATG
CA_C0028 hydA F: GGAAAATGCGGAGTCTGTATGG
R: TGGCAACACAAGCAGCTCTAA