Skip to main content

Table 7 Oligonucleotide primers

From: Strain and bioprocess improvement of a thermophilic anaerobe for the production of ethanol from wood

Primer Description Sequence
X04986 perR up-stream forward primer tttcgactgagcctttcgttttatttgatgcctggTTTGTAATAAAGTCTGCCGT
X04987 perR up-stream reverse primer AATTGTAGAATACAATCCACTTCACAATGGGCACGTTTTCTTTCAGGATTGACGA
X04989 perR down-stream reverse primer CCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAGGCGATAAAGACTATGTAGA
X05122 perR down-stream forward primer aggggtcccgagcgcctacgaggaatttgtatcgCACAGATTACCTTTTGATGG
X07562 EPS up-stream forward primer tttcgactgagcctttcgttttatttgatgcctggccgaaaggataagagagcttgc
X07563 EPS up-stream reverse primer AATTGTAGAATACAATCCACTTCACAATGGGCACGGCATGATGAGGCGATACCTTGATG
X07564 EPS down-stream forward primer aggggtcccgagcgcctacgaggaatttgtatcggttcctgataaacctgtatcgccc
X07565 EPS down-stream reverse primer CCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGACTGCCAGCGATGTAAAGCATAG
X07568 EPS external primer 1 acttggatacaggcagtggaggaa
X07569 EPS external primer 2 TCCAGCATAGCCTGCAACTGGATA
X13281 perR external primer 1 agctatgctttctacccttgccca
X13282 perR external primer 2 AACGACAAGCAGTTTGTGCTTCCG
X15225 mgs up-stream forward primer agcttgatatcgaattcctgcagcccgggggatctCAGTGCGTCACACGCAGTTG
X15226 mgs up-stream reverse primer agaatacaatccacttcacaatgggcacgGGATCCGATCTTTTGCCTTCGCATCCC
X15227 mgs down-stream forward primer gtcccgagcgcctacgaggaatttgtatcgGATCCGGATTTTTGGAATGGAGAGATG
X15228 mgs down-stream reverse primer accgcggtggcggccgctctagaactagtGGATCTGGTCCTGCTAATGCGATGATG
X15767 mgs external primer 1 TGCACATTCAGTGCCGTTGTC
X15768 mgs external primer 2 GTAATCCAACTGAGTGCCGATG