Skip to main content

Advertisement

Table 3 Strains, plasmids and primers used in this study

From: Robust succinic acid production from crude glycerol using engineered Yarrowia lipolytica

Strain Genotype or relevant features Source
Y. lipolytica
 W29 MatA, Wild type INRA
 Po1g MatA, xpr2-322, axp-2, leu2-270 INRA
 Po1f MatA, xpr2-322, axp-2, leu2-270, ura3-302 INRA
 PGC01003 MatA, xpr2-322, axp-2, leu2-270, ura3-302, Δsdh5::URA3 This study
E. coli
 DH5α Competent Cells TransGen Biotech
Vectors
 pBluescript SK(−) Ampicillin resistance Stratagene
 pPUT pBluescript SK(−) containing the deletion cassette of PUT This study
Primers Sequences(5′ → 3′) Application
v-F AGCTCCAGCTTTTGTTCCCT Forward primer for pBluescript vector
v-R TCAAGCTTATCGATACCGTC Reverse primer for pBluescript vector
Ura-F CGCTCTAGAACTAGTGGA Forward primer for marker
Ura-R ACCCTCACTAAAGGGAAC Reverse primer for marker
Upper-F AGGTCGACGGTATCGATAAGCTTGAAGATCTTCCACTCGCTGTTC Forward primer for up segment
Upper-R CCTAGGATCCACTAGTTCTAGAGCGGTTCAAAGCTCGGGGTGTGT Reverse primer for up segment
Down-F CAGCTTTTGTTCCCTTTAGTGAGGGTGCTTACTGAGGAAGGTTCCT Forward primer for down segment
Down-R ACTAAAGGGAACAAAAGCTGGAGCTCAGTGTTCTGTGAACGCAAG Reverse primer for down segment
Chrom-F ACGACAATGGCATCGGCTCT Forward primer for verification
Chrom-R TCGCTTGGTCTCAGTCTCCT Reverse primer for verification