Skip to main content

Advertisement

Table 2 List of oligonucleotides used in this study

From: Genome editing of Clostridium autoethanogenum using CRISPR/Cas9

Oligonucleotide Sequence (5′ → 3′) Purpose
Og01 GATTATAAGCGGCCGGCCATAAACTATTTTTTAAAGATAAAAGCT PCR amplification of 5′-HA of adh
Og02 TACGCCGCCAGGTTTAACCAAAACCAGCTTGGACTTCTAAAGA PCR amplification of 5′-HA of adh
Og03 TCTTTAGAAGTCCAAGCTGGTTTTGGTTAAACCTGGCGGCGTA PCR amplification of 3′-HA of adh
Og04 CAACTTGCCCACTGGCCGGCCTGACTATTTCACTATGAGTAAATGGT PCR amplification of 3′-HA of adh
Og05 GAATGTGTTTAAACTCTCTGAAACTAGCAAATTTGG PCR amplification of 5′-HA of 2,3bdh
Og06 GAGATAATTATGAAAGCTGTATTGTGGTTGTAAAAGAAGGATTTGAAACAC PCR amplification of 5′-HA of 2,3bdh
Og07 GTGTTTCAAATCCTTCTTTTACAACCACAATACAGCTTTCATAATTATCTC PCR amplification of 3′-HA of 2,3bdh
Og08 AAAGGAGTTTAAACGAAAGTGAGCTTTTTGGTTATGAAAA PCR amplification of 3′-HA of 2,3bdh
Og09 TATTAACCTTATAAAGTCCTACCCC For screening
Og10 TAATCCTCCTCTTATAGTTTTGTGA For screening
Og11 CAAAAGCTATACTTAGTGCTAGATT For screening
Og12 TCATTTCTCTATCTTCAAAAAGTGT For screening
Og13 AGCTGTAGATAACAATGGGATCAT For screening
Og14 GTGAGATATAATGAGAAACCTGATCC For screening
Og15 AATGGCAGGGCAGATAATTGTAATG For screening
Og16 AAGGCATTCTGAGCCAGTTCTTTTA For screening
Og17 TAACGTCCTTAACTATTTATCAATTCGATCGACTAT To construct variants of ptet3no
  1. The table also includes the purpose of each oligonucleotide