Skip to main content

Table 1 Primer details

From: T-6b allocates more assimilation product for oil synthesis and less for polysaccharide synthesis during the seed development of Arabidopsis thaliana

Primer name Gene name Primer sequence (5′-3′)
Primers for semi-quantitative/quantitative PCR
 QIKU1F IKU1 AGTTTTGGTCTAATACAGCTGAG
 Q-IKU1R GGTTGAGACTGAGACTGAGATT
 Q-IKU2F IKU2 CGTGTGAGACAAGCGTTAGC
 Q-IKU2R GAGGAGACTTGTCCGTGCAT
 Q-A/N-InvAF A/N-InvA CATACATTACAGCTTCAGAGTTGGG
 Q-A/N-InvAR GAGAATAATCCACCACAAACCAGAA
 QSBE2.1F SBE2.1 ATCATGGACTGCAGGTCGAAT
 QSBE2.1R TCCCGCTAACATCTTCGCCG
 QSUS2F Sus2 AAGCAAGAACAATGTTGGGCA
 QSUS2R GCTCAGTAAACCAACATGCTCATC
 QAPS1F APS1 TTCCTGATTTTAGTTTCTATGACCG
 QAPS1R TGATGAATTTTGCAGTTCTTGATAA
 QWRIF WRI1 AATTTTCCGGCAGAGACGTACA
 QWRIR CCTCCTGCGTATTATAGGTGCC
 QGL2F GLABRA2 GAAGCTCGTCGGCATGAGTGGG
 QGL2R TCTCTCGATTTCACTGTCTGGATTG
 QDGAT1F DGAT1 TTTGGTTAAACATATTGGCAGAGC
 QDGAT1R AATGATAATGGCGAGTGTCTTTGGT
 Q-MINI3F MINI3 TTTGATGATATTGCAACGGAA
 Q-MINI3R GATCCTTTGTGTCTTGCTTGT
 Actin2F Actin2 ATGGCTGAGGCTGATGATATTCAAC
 Actin2R TCTCAGCACCAATCGTGATGACTTG
 QUBQ10F Ubiquitin10 AGGTACAGCGAGAGAAAGTAGCA
 Q-UBQ10R TAGGCATAGCGGCGAGGCGT
 Q6bF T-6b GACGAGATCAACGGTGCAAG
 Q6bR TGACAAGGTCTCCGAACTGG
Primers used in the construct
 Gt1F Gt1 promoter GGAATTCCAGGTCATAGGGAGAGGGAGCTTTTG
 Gt1R TTGGCGCGCCAAGTTGTTGTAGGACTAATGAACTGAA
 6bF T-6b TTGGCGCGCCAAATGACGGTAGCCAATTGGCAGGTTC
 6bR CCTTAATTAAGGCTATGCCGAAAGACGGCTTGACCCT