Skip to main content

Table 1 Primers in this study

From: Improving acetyl-CoA biosynthesis in Saccharomyces cerevisiae via the overexpression of pantothenate kinase and PDH bypass

Primer no. Sequence (5′–3′)
1 GTCAACTAGTATGCCGCGAATTACTCAAGAG
2 GTACAAGCTTCTACGTACTTGTTTTCTTAGTAG
3 GTCAGAGCTCACTTCTCGTAGGAACAATTTC
4 GTCAACTAGTTTTTTGATTAAAATTAAAAAAAC
5 ATCTGAGCTCGGATCCACTCGAGAGCTAGCAGCGGCCGCCACACACCATAGCTTCAA
6 GTGTAGCTTAGTCATTTTGTAATTAAAACTTAG
7 AGTTTTAATTACAAAATGACTAAGCTACACTTTGAC
8 TCATAAGAAATTCGCTTACAACTTAATTCTGACAGC
9 AGAATTAAGTTGTAAGCGAATTTCTTATGATTTATG
10 CTATGAGCTCGATCCGTGTGGAAGAACG
11 TTGTAATCGTTCTTCCACACGGATCTGGGGCCGTATACTTACATAT
12 TGGAGCAACACAATCACCCATGTTTAGTTAATTATAGTTCGT
13 ACGAACTATAATTAACTAAACATGGGTGATTGTGTTGCTCCA
14 GTAAAGACATAAGAGATCCGCTTACTTTGGCAAATCACCAGA
15 TCTGGTGATTTGCCAAAGTAAGCGGATCTCTTATGTCTTTAC
16 AAACATTTTGAAGCTATGGTGTGTGGGCATGCGAAGGAAAATGAGA
17 GATGATAGTTGATTTCTATTCCAACAGTGAGTAAGGAAAGAGTGAGGAAC
18 AACAGAAACTGGTGGAGACATTGTTTTATATTTGTTGTAAAAAG
19 CTTTTTACAACAAATATAAAACAATGTCTCCACCAGTTTCTGTT
20 CATAAATCATAAGAAATTCGCTTAAACACCAATAACTGGAAT
21 ATTCCAGTTATTGGTGTTTAAGCGAATTTCTTATGATTTATG
22 TACTATATGTAAGTATACGGCCCCAGGATCCGTGTGGAAGAACGAT
23 TCTCATTTTCCTTCGCATGCCCACACACCATAGCTTCAAAATG
24 AAGGGTTGTCGACCTGCAGCGTAGCAAATTAAAGCCTTCGAGC
25 TGGGACGCTCGAAGGCTTTAATTTGCTACGCTGCAGGTCGACAAC
26 CAACAACACCTGCTTCATCAGCTGTTACGACTCACTATAGGGAGACCG
27 CTCGAGGGATATAGGAATCCTC
28 GTTCCTCACTCTTTCCTTACTCACTGTTGGAATAGAAATCAACTATCATC
29 CCGGTCTCCCTATAGTGAGTCGTAACAGCTGATGAAGCAGGTGT
30 GAGAACTTCTAGTATATTCTGTATACCTAATATT